Labshake search
Citations for Thermo Fisher :
3401 - 3450 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... in which the lac-operator and the ribosome binding site (RBS) were replaced by the 5’-UTR of the in vitro expression vector pEXP-5-CT/TOPO (Invitrogen, Karlsbad, CA, USA). For cloning ...
-
bioRxiv - Molecular Biology 2021Quote: ... oligonucleotides from homologous regions D-ORF5 5′CCGctgagCAAGGTAGCCTCGTCTATTGGAC 3′ and R-ORF7 5′CCGctcgagTTCTTCATCTTCAATATTATGTC3′ were used using the PCR Reagent System Kit (Invitrogen, Life Technologies Inc.). The reaction mixture was prepared with l00 ng of recombinant TnGV DNA ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl of peptides solution was injected and concentrated on a μ-Precolumn Cartridge Acclaim PepMap 100 C18 (i.d. 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific) at a flow rate of 10 μL/min and using solvent containing H2O/ACN/FA 98%/2%/0.1% ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Molecular Biology 2022Quote: ... x 5 mm 5 μm 100 Å and an Acclaim PepMap RSLC 75 μm x 50 cm 2 μm 100 Å (Thermo Scientific). The columns were installed on an Ultimate 3000 RSLCnano system (Dionex) ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Biochemistry 2020Quote: ... strains were negatively selected against the URA3 marker gene using 1 mg/mL of 5-Fluoroorotic Acid (5-FOA) (Fisher Scientific, F10501-5.0) in SD-plates ...
-
bioRxiv - Pathology 2019Quote: ... The cells were maintained under standard cultural conditions at 37°C in an atmosphere of 5% CO2 and 5% O2 in a Heracell CO2 incubator (ThermoFisher Scientific, Waltham, MA) (28) ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... we incubated 3x10[6] cells in 1ml Schneider’s Medium including 10% FBS for 5 min at 25°C with or without 5 µg/mL puromycin (Gibco™ Sterile Puromycin Dihydrochloride). Cells were then washed twice and incubated for 50 min at 25°C ...
-
bioRxiv - Microbiology 2019Quote: ... Phosphopeptides were loaded onto a µ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 µm i.d.×5 mm, 5 µm, Thermo Scientific, MA, USA) and were separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Neuroscience 2021Quote: ... mice were euthanized and both striata were dissected immediately and homogenized using a glass dounce homogenizer (5 loose and 5 tight strokes) in buffer A of mitochondria isolation buffer (ThermoFisher Scientific, no. 89874) and kept on ice for 2 minutes ...
-
bioRxiv - Biophysics 2021Quote: ... Protein samples (12 μL) were mixed with 3 μL 5 M DTT and 5 μL 4x NuPAGE™ LDS sample buffer (Thermo Fisher Scientific) and incubated (95 °C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... Peptides were desalted on a reversed-phase PepMap 100 C18 μ-precolumn (5 μm, 100 Å, 300 μm i.d. × 5 mm, Thermo Fisher Scientific) before peptide separation on a nanoscale PepMap 100 C18 nanoLC column (3 μm ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µL of peptide solution was injected and concentrated on a µ-Precolumn Cartridge Acclaim PepMap 100 C18 (i.d. 5 mm, 5 mm, 100 Å, Thermo Fisher Scientific) at a flow rate of 10 mL/min and using solvent containing H2O/ACN/TFA 98%/2%/0.1% ...
-
bioRxiv - Molecular Biology 2022Quote: ... The HPLC coupled to the LTQ Orbitrap XL was equipped with two PepMapTM C18 μ-precolumns (ID: 0.3 mm × 5 mm, 5 µm, 300 Å Thermo Fisher Scientific) and an AcclaimTM PepMapTM analytical column (ID ...
-
bioRxiv - Biochemistry 2022Quote: ... as indicated in a trap and elute setting using an Acclaim™ PepMap™ 100 C18 trapping column (5 μM, 0.3 mm x 5 mm, Thermo Scientific™). All columns were operated at 50°C and connected to an EASY-Spray™ bullet emitter (10 μm ID ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Immunology 2022Quote: To analyze cell morphology 5×104 cells were resuspended in 100mL PBS and cytocentrifuged onto slides at 350g for 5 minutes (Thermo Scientific, Cytospin 4) before fixation in methanol for 15 minutes and staining with May-Grünwald’s (VWR Chemicals ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 µg of peptides were first loaded on an Acclaim PepMap 100 μ-precolumn cartridge (5 μm, 100 A, 300 μm ID x 5 mm, Thermo Fisher Scientific) and were then separated at 40 °C on a PicoTip emitter (noncoated ...
-
bioRxiv - Cell Biology 2024Quote: ... one well was loaded with 5 µg of input mitochondria previously diluted in 5 µL of 2x LDS dye (Thermo Fisher Scientific, 84788) with 2.75 mM β-mercaptoethanol (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... Membranes were washed 5 times for 5 minutes with PBS at room temperature and then exposed to Pierce ECL (Thermo Fisher Scientific, PI32106) for minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Microbiology 2023Quote: ... Phosphopeptides were loaded onto a µ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 µm i.d.×5 mm, 5 µm, Thermo Scientific, MA, USA) and were separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Genetics 2023Quote: Mouse Embryonic Fibroblasts were obtained from E12.5 mouse embryos and expanded for 10 days at 37 °C with 5% CO2 and 5% O2 in DMEM medium (Thermo Fisher Scientific, 31966021) supplemented with 10% FBS (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... The grids were blotted for 3.5 s with 3 force after waiting for 5 s and immersed in liquid ethane using Vitrobot (Mark IV, Thermo Fisher Scientific/FEI) in condition of 100% humidity and 8°C.
-
bioRxiv - Biophysics 2023Quote: ... The grids were blotted for 5 s with 3 force after waiting for 5 s and immersed in liquid ethane using Vitrobot (Mark IV, Thermo Fisher Scientific/FEI) in condition of 100% humidity and 8°C.
-
bioRxiv - Biochemistry 2024Quote: ... x 5 mm 5 μm 100 Å and an Acclaim PepMap RSLC 75 μm x 50 cm 2 μm 100 Å (Thermo Scientific). The columns were installed on an Ultimate 3000 RSLCnano system (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1% (v/v) TFA in water and injected onto a C18 PepMap100-trapping column (0.3 × 5 mm, 5 µM, Thermo Fisher Scientific, Waltham, USA) coupled to a C18 analytical column packed in-house (75 µM × 300 mm ...
-
bioRxiv - Cell Biology 2024Quote: ... The HPLC coupled to the LTQ Orbitrap XL was equipped with two PepMapTM C18 μ-precolumns (ID: 0.3 mm × 5 mm, 5 µm, 300 Å Thermo Fisher Scientific) and an AcclaimTM PepMapTM analytical column (ID ...
-
bioRxiv - Microbiology 2024Quote: Total RNA extracted from BoDV-2-infected Vero cells was ligated with either 5’ adaptor oligoRNA (5’-CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA (Thermo Fisher Scientific, USA; #L150201)) or 3’ adaptor oligoRNA (5’-GAAGAGAAGGUGGAAAUGGCGUUUUGG ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR targeting PTPRZ1 (5’-ACTCTGAGAAGCAGAGGAG-3’ and 5’-CTGTTGTCTGTAGTATCCATTAG-3’) or GAPDH (5’-TCAAGGCTGAGAACGGGAAG-3’ and 5’-CGCCCCACTTGATTTTGGAG-3’) was performed with Power SYBR™ Green PCR Master Mix (Applied Biosystems 4367659) in three technical replicates.
-
bioRxiv - Microbiology 2020Quote: ... Ultrathin sections of 50 nm were blocked with 5% fetal bovine serum/5% normal goat serum for 30 min and subsequently incubated with rabbit anti-GFP antibody (Life Technologies Corp., Eugene, OR) for 60 min at room temperature ...
-
bioRxiv - Systems Biology 2022Quote: Vector backbone was prepared by digesting 5 μg of CROPseq-CaptureSeq-Guide-Puro with 5 μl of FastDigest Esp3I (Thermo Scientific cat. no. FD0454) in a total volume of 50 μl 1× Thermo Scientific FastDigest Green Buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... peptides were loaded on an Acclaim PepMap 100 μ-precolumn cartridge (5 μm, 100 Å, 300 μm ID x 5 mm, Thermo Fisher Scientific). Then ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame without the initiating ATG was amplified by PCR using primers 5’-CACCGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™6.2/N-EmGFP-DEST (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame with the initiating ATG was amplified by PCR using the primers 5’-CACCATGGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™-DEST40 (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... The 5 mL HisTrap column was washed with 10 column volumes of wash buffer (2× GIBCO 14200-075 PBS, 5 mM Imidazole, pH 7.5) followed by 6 column volumes of elution buffer (2× GIBCO 14200-075 PBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... The tumor specimen was sectioned into 5×5 mm pieces under sterile conditions and coated in Matrigel (Cat No. 354234, Fisher Scientific, Waltham, MA, USA) to promote tumor take ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Bioengineering 2022Quote: ... All the cells were cultured at 37°C in 5% CO2 using 5 mL of Dulbecco modified Eagle medium (DMEM, Thermo Fisher Scientific, MA, USA)–high-glucose (4500 mg of D-glucose/liter ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’) using Amplitaq gold 360 (Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using ABI BigDye v3.1 cycle sequencing reagents and analyzed on an ABI 3130XL Genetic Analyzer ...
-
bioRxiv - Biochemistry 2019Quote: ... 300 μm × 5 mm, 5 μm, 100 Å, separation column: C18, Acclaim PepMap, 75 μm × 500 mm, 2 μm, 100 Å, Thermo Fisher Scientific). After loading the sample on the precolumn ...
-
bioRxiv - Developmental Biology 2020Quote: The retinas of juveniles (n = 6 retinas from 5 animals) and adults (n = 5 retinas from 4 animals) were dissected out and put in RNAlater (Ambion Inc., Austin, TX, USA). RNA extraction was performed using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... Ultrathin sections of 50 nm were blocked with 5% FBS/5% NGS for 30 min and subsequently incubated with rabbit anti-GFP (Life Technologies Corporation, Carlsbad, CA.)(1:200 ...
-
bioRxiv - Biophysics 2022Quote: Nascent transcription in nucleoli was measured by incorporation of 5-ethynyl uridine (5-EU) in cells using a Click-iT™ RNA Alexa Fluor™ 594 Imaging Kit (Fisher Scientific, C10330), according to the manufacturer’s recommended protocol except where noted in the following ...