Labshake search
Citations for Thermo Fisher :
3351 - 3400 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... blocked in 5% goat serum (Gibco, Cat# 16210-064) in PBS for 60 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mL sodium pyruvate (Gibco, 100 nM, #.11360-070), 10 mL sodium bicarbonate (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% (v/v) fetal bovine serum (Gibco #16000-044), penicillin and streptomycin (100 units/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μM Oregon Green™ 488 Azide (ThermoFisher, O10180), and premixed 2 mM CuSO4 and 4 mM THPTA (Lumiprobe ...
-
bioRxiv - Genetics 2024Quote: ... with 5% fetal bovine serum (FBS, Thermo Fisher # 16140071) and processed directly for single cell isolation ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% EtOH solution) passed the QC (with Thermo Scientific Dionex Ultimate 3000 UHPLC equipped with Waters XBridge BEH C18 analytical column [130 Å ...
-
bioRxiv - Neuroscience 2024Quote: ... with natural laminin (5 μg/mL, Gibco, 23017-015 ) in HBSS were dried onto the coverslip surface to create the spot gradients ...
-
bioRxiv - Microbiology 2024Quote: ... 5 ml/L MEM vitamin solution (Thermo Fisher Scientific); 150 ml/L MEM non-essential amino acid solution (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2024Quote: ... 5% CO2 and supplemented with 10% FBS (Life Technologies) and 1x nonessential amino acids (NEAA ...
-
bioRxiv - Microbiology 2024Quote: ... a 5’ RACE system (Thermo Fisher Scientific, Carlsbad, CA) was used according to the previous study [33] ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 ng/mL Epidermal Growth Factor (EGF) (Life Technologies), 400 ng/mL hydrocortisone (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 5% Knockout serum replacement (Thermo Fisher Scientific), 10 ng/ml FGFb ...
-
bioRxiv - Neuroscience 2024Quote: ... for 5 minutes and mounted using Fluoromount-G (Invitrogen). Images were collected using a whole slide scanning microscope with a 10X objective (Olympus ...
-
bioRxiv - Bioengineering 2024Quote: ... with 5 % B27 supplement (17504044, Gibco, Thermo Fisher Scientific) and 10 % Fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... on QuantStudio™ 5 Real-Time PCR system (Thermofisher). List of primers are provided in Supplementary Table 1.
-
bioRxiv - Cell Biology 2024Quote: ... Alexa Fluor 488 Conjugate (5 μg/mL, Invitrogen, W11261). Added mouse Anti-cTnT (1:300 ...
-
bioRxiv - Microbiology 2024Quote: ... Data were analyzed using ABI QuantStudio 5 (Applied Biosystems). All viral RNA levels were normalized to 18S levels ...
-
bioRxiv - Microbiology 2024Quote: ... or QuantStudio 5 Real-time PCR system (ThermoFisher Scientific).
-
bioRxiv - Immunology 2024Quote: ... DAPI staining (1:5000 in ddH2O; 5 minutes) (ThermoFisher) was performed last and was washed off for 5 minutes before mounting with ProLong Diamond Antifade Mountant (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl RiboLock RNase Inhibitor (Thermo Fisher Scientific, E00381), 20 µl fragmented mRNA ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 µM heparin (H19, Thermo Fisher Scientific, Waltham, MA) was added to the solution to induce aggregation and the solution was placed on the shaking incubator with a speed of 1000 rpm for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl of 10X Turbo DNase Buffer (Thermo Fisher) and 3 µl of TURBO RNase (Thermo Fisher ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 5% horse serum (16050130, Thermo Fisher Scientific), 1% Pen/Strep 1000U/mL ...
-
bioRxiv - Physiology 2024Quote: ... 2-amino-5-methoxybenzoic acid 1 M (ThermoFisher Scientific) in DMSO ...
-
bioRxiv - Cell Biology 2024Quote: ... DTT (dithiothreitol; Thermo Fisher Scientific, cat. no. BP172-5). Protease inhibitor cocktail (MilliporeSigma ...
-
bioRxiv - Cell Biology 2024Quote: ... Reactions were performed on QuantStudio™ 5 (Thermo Fisher) and results were analysed with QuantStudio Design & Analysis Software (v1.5.2 ...
-
bioRxiv - Cell Biology 2024Quote: ... and stained with 5 µg/mL propidium iodide (Invitrogen) for 1 hour.
-
bioRxiv - Pathology 2024Quote: ... on an Applied Biosystems QuantStudio 5 (Thermo Fisher Scientific) in 384-well plates ...
-
bioRxiv - Microbiology 2024Quote: ... 5 U of DreamTaq DNA Polymerase (Thermo Fisher Scientific), and 1 μL of extracted DNA (15-25 μg/mL) ...
-
bioRxiv - Genomics 2024Quote: ... 5 µL of 5x TBE Loading Buffer (Invitrogen; LC6678) was added and loaded in a 12-well 10% TBE gel (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... PCR reactions were run on Quantstudio 5 (Applied Biosystems) sequence detection system platform ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% heat-inactivated fetal bovine serum (A5256701, Gibco), L-glutamine (2 mM ...
-
bioRxiv - Plant Biology 2024Quote: ... and QuantStudioTM 5 Real-Time PCR instrument (Applied Biosystems). Relative transcript abundance was calculated by normalization to that of ACTIN (AT3G18780) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 µM DR (Thermo Fisher Scientific, 62-254), and sorted on an ARIA II FACS at a low flow rate ...
-
bioRxiv - Systems Biology 2024Quote: ... and 5 µL of 10X Turbo DNase buffer (ThermoFisher) were added and samples were incubated at 37°C for 20 min ...
-
bioRxiv - Synthetic Biology 2024Quote: ... were transferred to a 5 mL FACS tube (Invitrogen) and diluted to appropriate density with PBS buffer for FACS sorting ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 5% fetal bovine serum (FBS, Gibco, 16000044), 1% Penicillin / Streptomycin (Pen/Strp ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 µg/ml blasticidin (Thermo Fisher Scientific; R21001). Lenti-X HEK293T cells were cultured in Dulbecco’s modified Eagle medium supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... anti-CD4 (1:500, clone RM4-5; Thermo Fisher), overnight at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 µM Vybrant DyeCycle Ruby (ThermoFisher Scientific, #V10273) diluted in McIlvaine’s buffer ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Systems Biology 2022Quote: ... Vector backbone was prepared by digesting and dephosphorylating 5 μg of CROPseq-CaptureSeq-Guide-Puro with 5 μl of FastDigest Esp3I (ThermoFisher cat. no. FD0454) and 2 μl of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher cat ...
-
bioRxiv - Biochemistry 2022Quote: ... Labeled peptides were first trapped on an Acclaim™ PepMap™ 100 C18 precolumn (5 μM, 0.3 mm X 5 mm, Thermo Fisher Scientific) and eluted to the analytical column nanoEase M/Z Peptide BEH C18 Column (130Å ...
-
bioRxiv - Molecular Biology 2020Quote: ... and shRNA plasmids or pCDH plasmids by PEI-40000 with the ratio of 5: 1: 5 in opti-MEM (Gibco, Thermo Fisher Scientific). Virions were collected after 48 h after transfection ...
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... The expression of SLC6A14/ATB0,+ was measured using specific forward/reverse primers (5’GCTGCTTGGTTTTGTTTCTCCTTGGTC3’ and 5’GCAATTAAAATGCCCCATCCAGCAC3’) and SYBR™ Green PCR Master Mix (Thermo Fisher Scientific); the amount of SLC22A5/OCTN2 and that of the housekeeping gene RPL15 (Ribosomal Protein Like 15 ...
-
bioRxiv - Biochemistry 2020Quote: ... Peptides originating from in-solution digestion of ROS preparations and HEK293 cell membranes were concentrated and desalted on a C18 precolumn (Acclaim PepMap, 300 μM * 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific) with 0.1% TFA at a flow rate of 30 μl/min for 15 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... Three microliters of each sample were loaded onto a C18 precolumn (C18 PepMap 100, 300 μm x 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific) with 15 μL/min solvent A (0.1% FA in H2O ...
-
bioRxiv - Neuroscience 2020Quote: ... After a final wash (5 × 5 min), tissue was mounted with polyvinyl alcohol mounting medium (MilliporeSigma, Burlington, MA) and coverslipped (Thermo Scientific, Portsmouth NH).