Labshake search
Citations for Thermo Fisher :
3501 - 3550 of 10000+ citations for 7 Methyl 1 2 3 4 tetrahydroisoquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and cDNAs were synthesized using SARS-CoV-2 nucleocapsid (N) reverse primer N660R (5’-AGCAAGAGCAGCATCACCGCCATTGCCAGC-3’) and M-MLV reverse transcriptase (Invitrogen). Then ...
-
bioRxiv - Genomics 2021Quote: ... assembly was performed by mixing 2-3 sgRNAs (a total of 120 pmol) with 8.5 μg recombinant Cas9 (Invitrogen A36499). The resulting RNP mix was electroporated into 0.3E6 MV411 cells using a Lonza 4D Nucleofector ...
-
bioRxiv - Cell Biology 2020Quote: ... rabbit anti-ZO-2 pAb (38-9100) and rabbit anti-ZO-3 pAb (36-4100) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Cultures were regularly monitored for bacterial contamination by checking for bacterial growth in Zobell marine broth 2216 (HiMedia) (71) in addition to filtering 2-3 mL of exponential-phase growing culture and using Sybr Green I (Invitrogen) staining and epifluorescence microscopy (Nikon Eclipse 80i ...
-
bioRxiv - Molecular Biology 2021Quote: ... For cell collection and/amplification ESCs were trypsinized for 2 to 3 minutes with trypsin-EDTA (Invitrogen, Cat#25200-072) and the digestion was stopped by the addition of pre-warmed 15% FCS ...
-
bioRxiv - Immunology 2020Quote: ... 2 and 3 cDNA were amplified by real-time PCR using the SYBR Green PCR kit (Thermo Scientific, Braunschweig, Germany). The primer sequences used for the real-time PCR were listed in Table 1.
-
bioRxiv - Cancer Biology 2022Quote: ... Panel 2: (PE-Cf594 Ly6G, PerCP-Cy5.5 Ly6C, FITC CD11b) and Panel 3: Alexa fluor 594 anti-mCherry (ThermoFisher-M11240), Alexa fluor 647 CD34 (BD 560230) ...
-
bioRxiv - Microbiology 2022Quote: ... Approximately 10 μg protein and BSA for the negative control were denatured at 70°C for 10 min with LDS buffer and reducing agent (Novex) and migrated with a 3 to 198 kDa molecular weight marker (SeeBlue plus 2, Invitrogen). A gel-sized PVDF membrane (Amersham ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was measured by MTT assay using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide kit (Thermo-Fisher Scientific M6494). For the isobologram assays ...
-
bioRxiv - Cell Biology 2022Quote: ... 22 x 30mm #1.5 glass coverslips were activated by incubating with a 2% solution of 3-aminopropyltrimethyoxysilane (313255000, Acros Organics) diluted in isopropanol ...
-
bioRxiv - Biochemistry 2022Quote: ... Peptides were separated using 50 cm Acclaim PepMap 100 analytical column (75 μm ID, 3 μm C18) in conjunction with a Pepmap trapping column (100μm × 2 cm, 5 μm C18) (Thermo Scientific) analysed with Orbitrap Fusion Tribrid mass spectrometer (Thermo-Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: At 2-3 dpf the embryos were paralyzed with intramuscular injections of 750μg/ml α-bungarotoxin (Life Technologies, Waltham, USA), then individually embedded in low melting agarose (Life Technologies) ...
-
bioRxiv - Molecular Biology 2024Quote: The transfection of a mixture of specific siRNA against c-Myc protein (exon 2 and exon 3, IDs s9129 and s9130, respectively; Ambion) and DOT1L protein (IDs s39011 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Peptides were applied on an Acclaim PepMap 100 C18 trap column (75 µm ID × 2 cm, 3 µm; Thermo Scientific) in 0.1% formic acid and 2% acetonitrile in H2O at a constant pressure of 80 MPa and separated by a linear gradient of 2%–6% buffer B in buffer A for 3 min ...
-
bioRxiv - Cell Biology 2024Quote: ... induction medium was replaced every 2-3 days by mature medium containing StemPro-34 SF medium (Gibco, Thermo Fisher Scientific), GlutaMAX (10 μl/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... induction medium was replaced every 2-3 days by mature medium containing StemPro-34 SF medium (Gibco, Thermo Fisher Scientific), GlutaMAX (10 μl/ml ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... total RNA was extracted from 2–3-day-old female adult mosquitoes using TRIzol Reagent (Thermo Fisher Scientific, MA, USA). The reverse transcription reaction was performed in a 20 μl reaction mixture with 5 μg total RNA ...
-
bioRxiv - Molecular Biology 2022Quote: 4 L exponentially growing Sf9 cells at a density of 2-3 × 106 cells/mL in Sf900-III SFM media (Invitrogen) was infected with the high-titer baculovirus stock ...
-
bioRxiv - Microbiology 2023Quote: ... Five microliters were loaded onto an Acclaim PepMap™ precolumn (75 μm × 2 cm, 3 μm, 100 Å; Thermo Scientific) equilibrated in solvent A and separated at a constant flow rate of 250 nL/min on a PepMap™ RSLC C18 Easy-Spray column (75 μm × 50 cm ...
-
bioRxiv - Systems Biology 2023Quote: ... assembly was performed by mixing 2-3 sgRNAs (a total of 120 pmol) with 8.5 μg recombinant Cas9 (Invitrogen A36499). The resulting RNP mix was electroporated into 0.3×106 MV411 cells using a Lonza 4D Nucleofector ...
-
bioRxiv - Molecular Biology 2023Quote: ... hESCs were differentiated into cardiac mesoderm by culturing for 3 days in RPMI B27-medium (RPMI 1640 GlutaMAX + 2% B27 supplement minus insulin (ThermoFisher), 200 μM L-ascorbic acid (Sigma) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 min) and suspended in 50 µl of TSB-FBS supplemented with 2 U of DNase I (Thermo Fisher Scientific). After 5 min incubation at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 min) and suspended in 30 µl of TSB-FBS supplemented with 2 U of DNase I (Thermo Fisher Scientific). After 5 min incubation at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... Washes of 3 x 1ml PGAS and 2 x 1ml PBS followed by 1ml PBS containing 1μg/ml Hoechst 33342 (Life Technologies) and finally 2 washes in dH2O prior to mounting on glass slides with Mowiol 4-88 (Polysciences Inc.) ...
-
bioRxiv - Biochemistry 2023Quote: ... In between wash steps the beads were incubated for 3 min on a magnetic stand (DynaMag 2, DYNAL®, Invitrogen). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... C3H female mouse in origin) were cultured every 2-3 days using 0.25% Trypsin-EDTA and maintained in DMEM (GIBCO, 11965118) supplemented with 20% iFBS and 1% Penicillin/Streptomycin ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Libraries were prepared for long-read sequencing by digesting 2 µg of a level 3 plasmid library using Esp3I (Thermofisher) and purifying linearized fragments using a 0.5x volume of magnetic beads (Omega Bio-Tek ...
-
bioRxiv - Neuroscience 2023Quote: ... Ten microliters of each sample were loaded onto a trap column (100 mm i.d. x 2 cm; Acclaim PepMap C18, 3 mm, 100A; ThermoFisher 164564) in 0.1% formic acid in water ...
-
bioRxiv - Biochemistry 2023Quote: ... Each sample of peptides was loaded onto a C18 trap column (75 μm ID × 2 cm, 3 μm, Thermo Scientific) and then separated on a C18 analytical column (75 μm ID×50 cm ...
-
bioRxiv - Genomics 2023Quote: ... For the construction of the RNH2A KO clones, RNASEH2A (Chr19, exon 2) gRNA (5’-TAACAGATGGCGTAGACCAT-3’) was cloned into GeneArtTM CRISPR Nuclease Vector with OFP reporter (Invitrogen) following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The isolated cells were expanded in tissue culture flasks for 2-3 days in proliferation medium containing DMEM/F-12 media (Gibco), penicillin-streptomycin (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... cells in each well were firstly washed with flow cytometry staining buffer: 3% FCS with 2 mM EDTA (15575020; Invitrogen) in PBS− ...
-
bioRxiv - Plant Biology 2023Quote: ... PI staining seedlings were washed for 2-3 min in water and transferred to a chambered cover glass (Thermo Scientific), and imaged either using Confocal laser scanning (CLSM ...
-
bioRxiv - Immunology 2023Quote: ... The membrane was then washed 3 times with TBS-T and 2 times in TBS and developed using SuperSignal West Pico PLUS Chemiluminescence reagent (ThermoFisher). The resulting membrane was imaged on a BioRad ChemiDoc system and visualized using Image Lab software (BioRad) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... LentiX HEK293T and 143b osteosarcoma cells adherent cell lines were passaged every 2-3 days by dissociating in 0.05% trypsin (Life Technologies) for 5 min at 37 °C or 1x DPBS supplemented with 2% FBS and 5 mM EDTA for 10 - 15 min at 37 °C to remove from culture plates ...
-
bioRxiv - Cell Biology 2023Quote: ... induction medium was replaced every 2-3 days by mature medium containing StemPro-34 SF medium (Gibco, Thermo Fisher Scientific), GlutaMAX (10 μl/ml ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... were incubated at 37°C for 2 h and analyzed by SDS-PAGE on a 3-8% tris-acete NuPAGE gel (Invitrogen) and stained with Pierce Silver Stain Kit (Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... induction medium was replaced every 2-3 days by mature medium containing StemPro-34 SF medium (Gibco, Thermo Fisher Scientific), GlutaMAX (10 μl/ml ...
-
bioRxiv - Physiology 2024Quote: Mouse DRG neuron cultures were loaded for 30 min at 37 °C with 3 µM Fura-2 AM (Invitrogen F1221) in ES containing also 0.02% Pluronic F-127 and left to recover for about 10 min in ES before recording ...
-
bioRxiv - Molecular Biology 2024Quote: ... MEFs and HeLa) or 2 µL of Lipofectamine 2000 (Calu-3 and VeroE6) according to the manufacturer’s recommendation (ThermoFisher and Invitrogen, respectively). For co-transfections ...
-
bioRxiv - Bioengineering 2024Quote: ... and fresh media was added and incubated for a further 24 hours before performing the viability assay using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Thermo Fisher Scientific). The media was replaced with fresh cell culture media containing MTT (0.25 mg/mL ...
-
bioRxiv - Developmental Biology 2024Quote: ... cell vials were thawed 2-3 min in a 37°C water bath and transferred in T25 cell culture flasks (Gibco) with 5ml of hASC culture medium containing Minimum Essential Mediun (αMEM ...
-
bioRxiv - Molecular Biology 2019Quote: ... Antibody-bound chromatin was captured with magnetic beads for 1 h at 4°C (50 μl 1:1 mixture of Dynabeads Protein A and Dynabeads Protein G, Invitrogen). DNA from both input and ChIP samples was then extracted using phenol/chloroform ...
-
bioRxiv - Molecular Biology 2021Quote: ... the input aliquot (100 µl) was mixed with equal volume of 2× protein sample buffer (2× NuPAGE LDS buffer [Life Technologies], 100 mM DTT, 4% [w/v] SDS) and the IP with 100μl 1 x protein sample buffer followed by incubation for 10 min at 75 °C ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C (for P. miniata) or 20C (for P. regularis) in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Neuroscience 2020Quote: ... freshly mitochondria isolated from pupae were resuspended in respiration buffer (0.5 mg/ml) containing Tetramethylrhodamine methyl ester perchlorate (0.5 μM) (Thermo Fisher). The excitation spectra were scanned from 520 nm to 580 nm using 590 nm emission wavelengths ...
-
bioRxiv - Microbiology 2021Quote: ... and cells were overlayed with carboxy-methyl cellulose (CMC) containing media (0.6% CMC, MEM supplemented with 1X Penicillin/Streptomycin (Gibco), 2% FBS ...
-
bioRxiv - Biochemistry 2021Quote: ... The RBD/Legobody complex at 2.5mg/ml were incubated with MS(PEG)12 methyl-PEG-NHS-ester (Thermo Fisher) at a 1:25∼28 molar ratio for 2 hrs on ice ...