Labshake search
Citations for Thermo Fisher :
3301 - 3350 of 10000+ citations for 7 Methyl 1 2 3 4 tetrahydroisoquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Amplification was performed on QuantStudio 7 Flex® (Applied Biosystems). Beta-actin was used as an endogenous control for normalisation of target genes ...
-
bioRxiv - Immunology 2020Quote: ... in a ViiA 7 Real-Time PCR system (Applied Biosystems). The relative expression of target genes was confirmed using the quantity of target gene/quantity of GAPDH ...
-
bioRxiv - Cell Biology 2020Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). The copy number for each transcript is expressed relative to that of housekeeping gene HPRT1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 7 ppm (v/v) β-mercaptoethanol (Life Technologies, 21985-023), 4 ng/mL bFGF (Peprotech ...
-
bioRxiv - Immunology 2022Quote: ... and IL-13 (Alexa Fluor 488, or PeCyanine 7, Invitrogen; or eFluor 660 ...
-
bioRxiv - Pathology 2019Quote: ... on QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). PCR primers were designed to specifically amplify genes of interest (table S2) ...
-
bioRxiv - Genomics 2019Quote: ... on a ViiA 7 Real-Time PCR System (Thermo Fisher). Analysis was performed using the ΔΔCt method (Livak and Schmittgen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Granzyme B (effector T cells, GRB-7, Thermo Fisher Scientific), CD68 (macrophages ...
-
bioRxiv - Immunology 2020Quote: ... or Annexin V cell apoptosis kit with 7-AAD (ThermoFisher) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... Analysis was performed with ViiA™ 7 Software (Thermo Fisher). The fold change gene expression in the fetal corneas at 9 wg ...
-
bioRxiv - Microbiology 2020Quote: ... and run on a QuantStudio 7 Flex instrument (Applied Biosystems) under the following cycling conditions ...
-
bioRxiv - Immunology 2021Quote: ... using the ViiA-7 Real-Time PCR system (Applied Biosystems), and the expression levels were normalized to GAPDH.
-
bioRxiv - Immunology 2019Quote: ... Monocytes were incubated for 7 days with RPMI-1640 (Gibco) supplemented with 100 ng/ml MCS-F (#300-25-100 ...
-
bioRxiv - Genetics 2020Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). Primers for the gene M04F3.3 / kin-35 were used (Forward CGGTTGAATATTGGTGAGGAGGTT ...
-
bioRxiv - Physiology 2021Quote: ... in the ViiA 7 Real-Team PCR System (Thermo Fisher) with the following times ...
-
bioRxiv - Physiology 2020Quote: ... 7-AAD or fixable viability dye eFluor780 (Thermo Fisher Scientific) served as a live-dead stain ...
-
bioRxiv - Physiology 2021Quote: ... in a ViiA 7 Real-Time PCR System (Applied Biosystems) using ViiA 7 Software (Applied Biosystems).
-
bioRxiv - Genomics 2021Quote: ... (7) we relaxed the filtering criterion used by Thermo Fisher Scientific and selected the best markers in the remaining set ...
-
bioRxiv - Bioengineering 2021Quote: ... using the ViiA™7 RT-PCR System (Applied BioSystems). Quantification was performed by calculating the ΔCt value using GAPDH as a reference and results are shown as mRNA expression levels (2-ΔCt ...
-
bioRxiv - Genetics 2021Quote: ... on a ViiA 7 Real-Time PCR system (Applied Biosystems). Four technical replicates were pipetted on a 384-well plate using the JANUS automated workstation (PerkinElmer) ...
-
bioRxiv - Cell Biology 2020Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). Primer sequences are listed below.
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 7% heat-inactivated fetal bovine serum (FBS, Gibco), 2 mmol/L Glutamax (Gibco) ...
-
bioRxiv - Microbiology 2022Quote: ... in a ViiA 7 Real-time PCR system (Applied Biosystems) for 40 cycles with two steps per cycle.
-
bioRxiv - Microbiology 2022Quote: ... in a ViiA 7 Real-time PCR system (Applied Biosystems) for 40 cycles with two steps per cycle ...
-
bioRxiv - Immunology 2022Quote: ... HEK293 and COS-7 cells and Lipofectamine 2000 (Thermo Fisher) reagent for NIH3T3 cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... on microscopy plates (Cat. #12-544-7, Thermo Fisher Scientific), and sealed with nail polish (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... on ViiA™ 7 Real-Time PCR System (Applied Biosystems) using Platinum™ SYBR™ Green qPCR SuperMix-UDG w/ROX (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... on a ViiA 7 Real-Time PCR system (Applied Biosystems). 18S rRNA served as the internal control ...
-
bioRxiv - Cell Biology 2022Quote: ... on QuantStudio 7 Flex Real time PCR system (Applied Biosystems). Reactions were performed in triplicate and RNA expression was normalised to 36b4 ...
-
bioRxiv - Cell Biology 2022Quote: ... using a ViiA-7 Real-Time PCR system (Applied Biosystems). Fold change in expression was calculated by the ΔΔCt method using actin as a control ...
-
bioRxiv - Pathology 2022Quote: ... with QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). The following primers were used in qPCR experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples wererun on a QuantStudio 7 Flex system (Applied Biosystems) using manufacturer ‘s recommended cycling conditions ...
-
bioRxiv - Physiology 2023Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). Four technical replicates were averaged for each sample per primer reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with 7% (v/v) fetal bovine serum (Thermo Scientific) and 100 U/ml penicillin-streptomycin (Gibco) ...
-
bioRxiv - Microbiology 2022Quote: ... A ViiA 7 real-time PCR system (Thermo Fisher Scientific) was used to determine each reaction cycle threshold ...
-
bioRxiv - Plant Biology 2024Quote: ... in a ViiA 7 Real-time PCR system (Applied Biosystems) for 40 cycles with two steps per cycle ...
-
bioRxiv - Immunology 2023Quote: ... Data were processed using ViiA™ 7 Software (Applied Biosystems) and analyzed with the 2(−ΔCT ...
-
bioRxiv - Molecular Biology 2024Quote: ... in a ViiA 7 Real-Time PCR machine (Life Technologies). When measuring ‘A-tailed’ RNA levels ...
-
bioRxiv - Microbiology 2024Quote: ... and QuantStudio 7 Flex Real-Time PCR Systems (Applied Biosystems). Transcript copy numbers of target genes were determined using the QuantStudio Real-Time PCR Software v1.3 and then normalized to the housekeeping transcript for Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ...
-
bioRxiv - Physiology 2023Quote: ... with the ViiA 7 Real-Time PCR System (Applied Biosystems). Relative mRNA levels were normalized to GAPDH ...
-
bioRxiv - Immunology 2024Quote: ... qPCR was performed on a QuantStudio 7 Pro (Applied Biosystems) and analyzed using Design and Analysis v2.6 software (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... and a ViiA 7 Real-Time PCR System (ThermoFisher Scientific) as described (Andersson et al. ...
-
bioRxiv - Immunology 2024Quote: ... 7 µm sections were cut with a cryostat (Thermo Scientific, blade temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... Hela and MCF-7 cells using TRIzoL (Thermo Fisher Scientific). RNA was reversely transcribed to cDNA via iScriptTM Reverse Transcription Supermix (Bio-Rad Laboratories) ...
-
bioRxiv - Biophysics 2024Quote: ... 7 mL of His-Pur Ni-NTA resin (Thermo Scientific) was equilibrated in Buffer A containing 40 mM imidazole ...
-
bioRxiv - Cancer Biology 2023Quote: ... 7 μg/ml polybrene Polybrene (Thermo Fisher Scientific GmbH 11360039) was added to each viral sample ...
-
bioRxiv - Microbiology 2023Quote: ... in QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher). The relative change of viral RNA between the compound-treated infection samples and the control infection samples was calculated using the ΔCt values ...
-
bioRxiv - Microbiology 2023Quote: ... A ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) was used to amplify and quantify cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... 7-AAD viability staining solution (Thermo Fisher Scientific, 00-6993) was added ...
-
bioRxiv - Immunology 2023Quote: ... Zeba Spin Desalting Columns (7 K MWCO, 2ml. Thermo Fisher) were then used to separate crosslinked proteins from excess crosslinker and reaction byproducts ...