Labshake search
Citations for Thermo Fisher :
3651 - 3700 of 10000+ citations for 7 Methyl 1 2 3 4 tetrahydroisoquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Coverslips were mounted on glass slides in 4′,6-diamidino-2-phenylindole (DAPI) containing Fluoromount-G medium (Thermo Fisher). Images were acquired by an Eclipse A1 laser-scanning microscope ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Homogenised leaf tissues were centrifuged at 18,000 g 10 min 4 °C and 2 μL supernatant mixed with 48 μL Bradford reagent (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... Grids were blotted for 4 seconds at -2 force and vitrified in liquid ethane using a MarkIV Vitrobot (ThermoFisher). The blotting chamber was maintained at 22°C and 100% humidity during freezing.
-
bioRxiv - Microbiology 2019Quote: ... After 4 washes with PBS 0.01% v/v Tween-20 and 2 washes with ELISA Light washing buffer (ThermoFisher), CSPD substrate with Sapphire II enhancer (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... The slides were washed and mounted with ProLong Gold antifade reagent with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen) and images were acquired using Nikon A1-R confocal microscope using the NIS Elements software ...
-
bioRxiv - Molecular Biology 2019Quote: ... Coverslips were washed in 0.1% IGEPAL/PBS and mounted using ProLong Gold antifade reagent with 4’-6-Diamidino-2-phenylindole (DAPI) (Invitrogen). Immunofluorescence studies in HeLa cells were carried out as described above ...
-
bioRxiv - Cell Biology 2019Quote: ... Mounting medium contained DAPI (4’, 6-diamidino-2-phenylindole) to visualize the nucleus (Molecular Probes Inc., Eugene, OR, USA). Negative controls were performed with either no primary or no secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated 5 minutes with at room temperature with 500 ng/ml 4’,6-Diamidino-2-Phenylindole Dilactate (DAPI; ThermoFisher) in DPBS and mounted in ProLong®Gold (ThermoScientific).
-
bioRxiv - Cell Biology 2020Quote: ... The immunoprecipitates were dissolved in 2×SDS loading buffer and resolved on NuPAGE 4–12% Bis-Tris gel (Invitrogen), and then silver stained using Pierce silver stain kit (Thermo) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissues were immersed in 2ml dissociation solution (2% FCS-PBS solution with approximate 145U/ml type 4 Gibco collagenase) and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... sections were incubated with 0.2 μM of 4’,6-diamidino-2-phenylindole (DAPI) (Molecular Probes, Life Technologies, Carlsbad, CA) in PBS pH 7.4 ...
-
bioRxiv - Cell Biology 2020Quote: ... sections were incubated with 0.2 μM of 4’,6-diamidino-2-phenylindole (DAPI) (Molecular Probes, Life Technologies, Carlsbad, CA) in PBS pH 7.4 ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μL of capture Ab (~4 μg/ml) or SARS-CoV-2 recombinant antigen (~0.2 mg/ml) in 1x PBS (Gibco) was loaded in each channel ...
-
bioRxiv - Developmental Biology 2022Quote: ... for 2 hours at 250mA and 4°C using cold transfer buffer (1.5x NuPAGE transfer buffer (Thermo Fisher Scientific), 10% methanol ...
-
bioRxiv - Cell Biology 2022Quote: ... or 2-well and 4-well chamber slides were transiently transfected with various cDNA constructs using Lipofectamine 2000 (Invitrogen) or FuGENE 6 (Promega ...
-
bioRxiv - Immunology 2022Quote: ... Cells then were washed twice with FACS buffer and stained for 5 minutes at 4°C with 0.5 mg/mL of 40,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher). PE and DAPI staining were measured with an iQue Screener Plus flow cytometer (Intellicyt ...
-
bioRxiv - Genetics 2022Quote: ... Coverslips were mounted with Prolong gold antifade reagent with 4′,6-diamidino-2-phenylindole (DAPI, P36931, Thermo Fisher Scientific) and analyzed under a Zeiss LSM 510 Meta Confocal microscope (Carl Zeiss ...
-
bioRxiv - Microbiology 2022Quote: ... PCDH1 variants (sEC1-2 and sEC1-4) were generated by cloning the following sequences into the pcDNA3.1 mammalian expression vector (ThermoFisher): EC1-EC2 (residues 1-284 ...
-
bioRxiv - Neuroscience 2023Quote: ... and concentrated by centrifugation at 85,000x g for 2 hours at 4°C in a Sorvall WX 100 Ultra Ultracentrifuge (ThermoFisher). The supernatant was discarded and viral pellet resuspended in a volume of PBS containing calcium and magnesium (#14090-055 ...
-
bioRxiv - Neuroscience 2022Quote: ... 4’,6-diamidine-2-phenylindole dihydrochloride And coverslipped using ProLong™ Gold Antifade Mountant (Invitrogen by Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2022Quote: ... 4’,6-diamidine-2-phenylindole dihydrochloride And coverslipped using ProLong™ Gold Antifade Mountant (Invitrogen by Thermo Fisher Scientific).
-
The logic of native enhancer-promoter compatibility and cell-type-specific gene expression variationbioRxiv - Genomics 2022Quote: ... All cell lines were passaged regularly (every 2 to 4 days) with Accutase (PAA) or TrypLE (Thermo Fisher Scientific), and ESCs and EpiSCs were occasionally selected for Oct4 expression with 1µg/ml puromycin (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 µL RNase A/T1 Mix (4 µg RNase A, 10 U RNase T1, ThermoFisher Scientific, MA, USA) at 37°C for 30 min to remove host-originating nucleic acids ...
-
bioRxiv - Cell Biology 2024Quote: ... Gels were functionalized with 0.1M sulfo-succinimidyl 6-(4’-azido-2’-nitrophenylamino) hexanoate (Sulfo-SANPAH) (Cat# 22589, Thermo Scientific) dissolved in HEPES before overnight incubation in collagen type-I solution (Catalogue # A1048301 ...
-
bioRxiv - Cell Biology 2024Quote: ... Slides were washed in PBS and nuclei were stained with 4’-6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) and mounted with an aqueous mounting medium (Aqua-Poly/Mount ...
-
bioRxiv - Molecular Biology 2023Quote: ... and MUTYH KO cells were obtained by infection of BJ FAP-TRF1 WT with lentivirus expressing respectively guide RNAs targeting OGG1 exon 4 (gRNA3, sequence GCTACGAGAGTCCTCATATG) and MUTYH exon 2 (gRNA5, sequence GCATGCTAAGAACAACAGTC) and selected with 1.5 µg/ml Puromycin (Gibco). OGG1 KO/MUTYH KO (DKO ...
-
bioRxiv - Microbiology 2023Quote: ... The obtained cDNA was diluted to 2-4 ng/µl for subsequent qPCR with the Sybr Green (Applied Biosystems) method ...
-
bioRxiv - Bioengineering 2023Quote: ... the retinal sections were mounted with Fluoromount G™ containing 2-(4-Amidinophenyl)-1H-indole-6-carboxamidine (DAPI, Invitrogen) for nuclei detection ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were stored in 2% PFA at 4°C prior to analysis using an Attune NxT Flow Cytometer (Invitrogen) in the Flow Cytometry Core Facility of the Faculty of Medicine & Dentistry at the University of Alberta ...
-
bioRxiv - Developmental Biology 2023Quote: ... resuspended in mounting media containing 4’,6’-diamidino-2-phenylindole (DAPI) (Fluoromount-G™ Mounting Medium, with DAPI, Invitrogen), incubated overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... (BEI NR-52310) or pSARS2-SΔCT and 4 μg pTRMPSS2 (VRC/NIAID) diluted in 2 mL OPTIMEM media (Gibco) (DNA OPTIMEM mixture) ...
-
bioRxiv - Bioengineering 2023Quote: ... We activate the gel surface by sulfosuccinimidyl 6-(4’-azido-2’-nitrophenylamino) (sulfo-SANPAH, Thermo Scientific, Cat. No. 22589), which allows covalent conjugation of type IV collagen to the gel surface ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were incubated with secondary antibodies for 2 hours at RT in a humid chamber and DNA was counterstained with 0.1 µg/ml of DAPI (DNA intercalator, 4’,6-Diamidino-2-Phenylindole, D1306, Invitrogen). Coverslips were mounted with ProLong Diamond Antifade (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were washed with SSCT and incubated with 600 nM 4′,6-Diamidin-2-phenylindol (Dapi, D1306, Thermo Scientific) for 10 minutes before final washing in SSCT ...
-
bioRxiv - Microbiology 2023Quote: ... 2 ug of EV protein content were separated on a 4-12% Bis-Tris gel (Thermo Scientific, Rockford, IL), then blotted onto a PVDF membrane ...
-
Entorhinal cortex vulnerability to human APP expression promotes hyperexcitability and tau pathologybioRxiv - Neuroscience 2024Quote: ... 2/3rd of the eluted protein samples were resolved on a 4–12% Bris-Tris gel (Invitrogen: cat# NW04125box) and subjected to Silverstein (Pierce™ Silver Stain Kit ...
-
bioRxiv - Cell Biology 2022Quote: The interaction between PAR-2 and GSP-1/-2 was assessed using a GAL4-based system (Gateway, Invitrogen) using the MAV203 yeast strain ...
-
Nanoscale molecular architecture controls calcium diffusion and ER replenishment in dendritic spinesbioRxiv - Neuroscience 2021Quote: Cultures were incubated for 1 h in Fluo-2 (high affinity) AM (2 μm; Invitrogen, Carlsbad, CA, USA) containing recording medium containing (in mM ...
-
bioRxiv - Microbiology 2022Quote: ... cells were grown in NB medium with Fe0 granules (2 g;1 to 2 mm diameter; Thermo Scientific) as the sole electron donor ...
-
bioRxiv - Cell Biology 2023Quote: ... eyes were moved to 2:1 Cryomatrix:30% sucrose for 2 hours and embedded in Cryomatrix (Fisher Scientific). Sections were collected on a Leica cryostat using charged Histobond slides (VWR ...
-
Arc mediates intercellular synaptic plasticity via IRSp53-dependent extracellular vesicle biogenesisbioRxiv - Neuroscience 2024Quote: ... with 4% sucrose/4% formaldehyde (ThermoFisher Scientific) in 1X PBS ...
-
bioRxiv - Bioengineering 2023Quote: ... Then the cells were stained with a solution of 4 mM calcein AM (TRC, #C125400) and 4 mM ethidium homodimer-1 (Thermo Fisher, #L3224) dissolved in PBS to identify live and dead cells ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 EV samples (2 per cell type, 1 ZIKV and 1 control each) were fixed in 2% paraformaldehyde (PFA; Fisher Scientific, Cat #50-980-487) and processed as cited 59 ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... FluoZin-3 (FluoZin™-3, AM, cell permeant, Thermo Fisher) was added at 1 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... DiIC12(3) (1,1’-Didodecyl-3,3,3’,3’-Tetramethylindocarbocyanine Perchlorate) (Invitrogen, D383) was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... mounting 3 dpf embryos in 3% methylcellulose (Thermo Scientific, 258111000). After imaging ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were blocked for 1 hour in 2 mg ml−1 BSA and 1% Goat Serum (Thermo Fisher) in 1X PBSTXD (1X PBS ...
-
bioRxiv - Immunology 2024Quote: ... CD206-FITC (19.2, 1:100), CD11c-PE (3.9, 1:50) and CD14-PerCP-Cy5.5 (61D3, 1:200) from eBiosciences (ThermoFisher) were used.