Labshake search
Citations for Thermo Fisher :
3501 - 3550 of 10000+ citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Processed proteins samples were run on 3–8% NuPAGE Tris-Acetate 1.5mM pre-cast gels (ThermoFisher, EA0378BOX) and primary antibodies used were ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein lysates were loaded into 3-8% Tris-Acetate mini gels (Thermo Fisher Scientific, cat no. EA03785BOX), separated electrophoretically ...
-
bioRxiv - Cell Biology 2020Quote: MEF R1441C cells were plated on 8-well dishes at 3×104 cells per each well (Nunc™ Lab-Tek™ II Chambered Coverglass from Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2019Quote: ... The apparent molecular weight was estimated in SDS-PAGE with 3-8% Tris-Acetate gels (Life technologies) using HiMark unstained protein standards (Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2021Quote: ... Equal protein lysates were run on Novex 3– 8% Tris-acetate 15 Well Mini Gels (EA03785BOX, Invitrogen) and transferred to Immobilon-P membranes (IPVH00010 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Equal protein lysates were run on Novex 3–8% Tris-acetate 15 Well Mini Gels (EA03785BOX, Invitrogen) and transferred to Immobilon-P membranes (IPVH00010 ...
-
bioRxiv - Cell Biology 2022Quote: ... 30µg/well of each sample was loaded onto NuPAGE Novex 3-8% Tris-Acetate gel (Thermo Fisher), and proteins were separated at a constant voltage of 150V for 1.5 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... or NuPAGE™ 3-8% Tris-Acetate gels in NuPAGE™ Tris-Acetate SDS Running Buffer (Invitrogen) where specified ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were separated using NuPAGE 3–8% Tris-Acetate Protein Gels (Life Technologies/Gibco®, Karlsruhe, Germany). For the detection of fibronectin ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were separated using NuPAGE 3–8% Tris-Acetate Protein Gels (Life Technologies/Gibco®, Karlsruhe, Germany). For the detection of fibronectin ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 8 mM Na2HPO4) including 3 μM acetoxymethyl (AM) ester calcium crimsonTM dye (Invitrogen, Carlsbad, CA, USA) for 30 min at 27 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 μg/lane of lysates were electrophoresed on NuPAGE 3–8% Tris-Acetate Gels (Thermo Fisher Scientific), while 10 μg/lane of lysates were electrophoresed on Bolt 4–12% Bis-Tris Plus Gels (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... A standardized quantity of protein was resolved using NuPAGE Tris-Acetate Protein Gel (3-8%)(Thermo Fisher) or NuPAGE Bis-Tris Protein Gel (4-12% ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were blotted onto PVDF membranes using iBlot (program 3 for 8 min; Invitrogen, Carlsbad, CA, USA). Blots were blocked in 5% nonfat dry milk (NFDM ...
-
bioRxiv - Cell Biology 2023Quote: Equal amounts of reduced protein were loaded into 3-8% Tris-Acetate Mini Gels (Thermo Fisher Scientific) and separated electrophoretically by molecular weight ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins were blotted onto PVDF membranes using iBlot (program 3 for 8 min; Invitrogen, Carlsbad, CA, USA). Blots were blocked in 5% nonfat dry milk (NFDM ...
-
bioRxiv - Bioengineering 2024Quote: ... The denatured protein samples were separated on NuPAGE™ 3–8% Tris-acetate gels (Cat #EA03785BOX, Invitrogen) according to manufacturer’s instructions and subsequently stained with Pierce™ silver stain kit (Cat # 24612 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 10μL soluble protein was loaded into a pre-cast NuPAGE 3-8% Tris-Acetate gel (Invitrogen). Proteins were transferred using an iBlot2 (Invitrogen ...
-
bioRxiv - Paleontology 2020Quote: ... for 3 min at a flow rate of 10 μl.min−1 on an Acclaim PepMap100 C18 pre-column (5 μm, 300 μm i.d. × 5 mm) from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated 1 hour with 5 μg/mL Hoechst 34580 (stock 5 mg/mL in H2O) (Thermo Fisher) and anti-mouse Alexa 647 in PBS+.
-
bioRxiv - Paleontology 2023Quote: ... for 3 min at a flow rate of 10 μl.min-1 on an Acclaim PepMap100 C18 pre-column (5 μm, 300 μm i.d. × 5 mm) from ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were subjected to SDS gel electrophoresis using 8% or 4-12% Bis-Tris gels (Invitrogen) and transferred nitrocellulose membranes for immunoblotting ...
-
bioRxiv - Cell Biology 2023Quote: ... the equivalent of 8-10 worms was loaded onto 4-12% NuPAGE Bis-Tris Gels (Invitrogen). Proteins were then transferred to nitrocellulose membranes ...
-
bioRxiv - Neuroscience 2024Quote: ... frozen in blocks of 4-8 cords/block in Shandon M1 Embedding Matrix (1310; Fisher Scientific), and cut in the sagittal plane at 20.0 µm thickness at -16°C on a cryostat ...
-
bioRxiv - Molecular Biology 2021Quote: ... falciparum Dd2 was cultured at 2-5% hematocrit in O+ erythrocytes in Malaria Culture Medium (MCM): RPMI 1640 supplemented with 5 g/L Albumax II (Gibco), 0.12 mM hypoxanthine (1.2 mL 0.1M hypoxanthine in 1 M NaOH) ...
-
bioRxiv - Microbiology 2022Quote: ... The F gene was PCR amplified using primers RSV F 5’ (5’GCAAGGATTCCTTCGTGAC3’) and RSV F 3’ (5’CACACCACGCCAGTAG3’) and Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Sanger sequencing was performed by Elim Biosciences.
-
bioRxiv - Molecular Biology 2021Quote: ... 25-30 μg of RNA was subjected to one round of poly(A) selection using the Poly(A)PuristTM MAG kit (Ambion) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... and VSV-G at a molar ratio of 1:2.3:0.2 using Lipofectamine 2000 (Thermo Fisher). Media was replenished 6 h post-transfection and the supernatant collected after a further 40 h ...
-
bioRxiv - Physiology 2021Quote: ... Adipogenic media for days 1-2 contained: DMEM with 4.5 g/L glucose (Thermo Fisher Scientific), 10% calf serum (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2022Quote: ... Cultures were then spun down at 3,000 x g and resuspended in 1 mL TRIzol (Invitrogen). Cells were disrupted with glass beads using the Biospec Mini Bead Beater 16 Cell Disrupter at 25°C for 1 min ...
-
bioRxiv - Microbiology 2020Quote: ... The precipitates were centrifuged at 10,000 × g (Sorvall Evolution, SLA-3000 Recent-1 rotor, Thermo Fisher) for 30 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 mg protein for each condition was incubated with antibody-coated Dynabeads Protein G (Invitrogen, 1003D). Antibody dilutions are provided in table S3 ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated for 1 hour on ice before addition of 0.5% G-250 sample additive (Invitrogen). Prepared samples were run on NativePAGE™ 3-12% Bis-Tris gels under native conditions at 150V for 30 minutes with 1x native cathode buffer (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... PD-1 PE (#12-9969-42) and Dynabeads Protein G (#10004) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... centrifuged (0.8 or 1 x 103 G, 10 min, 20 °C, Fisher Scientific AccuSpin Micro 17R) to remove access dye and kept at 37 °C until use ...
-
bioRxiv - Genetics 2020Quote: ... These were detected using secondary antibodies: goat anti-rabbit-HRP (G-21234, ThermoFisher Scientific, 1:750) and goat anti-mouse-HRP (G-21040 ...
-
bioRxiv - Immunology 2020Quote: ... plates were incubated for 1 h with secondary anti-rabbit HRP-conjugate antibody (Invitrogen; G-21234) diluted 1 ...
-
bioRxiv - Genomics 2021Quote: HepG2 (ATCC HB-8065) and derivatives were cultured in low-glucose DMEM (1 g/L, ThermoFisher) with 10% FBS (Axenia BioLogix ...
-
bioRxiv - Neuroscience 2024Quote: ... secondary Alexa Fluor goat anti-mouse immunoglobulin G (IgG) 594 (1:5000; Invitrogen, A11032, lot 1985396), and secondary Alexa Fluor goat anti-mouse IgG 488 (1:5000 ...
-
bioRxiv - Neuroscience 2024Quote: ... and Alexa Fluor 555 donkey anti-rabbit immunoglobulin G (1:200, Thermo Fisher Scientific; A-31572).
-
bioRxiv - Biophysics 2024Quote: ... Samples were desalted using a C18 HyperSep SPE cartridge (Thermo Fisher Scientific, 1 g bed weight), which was equilibrated with 10 mL MeCN + 0.1% formic acid (FA) ...
-
bioRxiv - Bioengineering 2023Quote: ... culture medium consisted of low glucose Dulbecco’s Modified Eagle Media (DMEM) (1 g/L (Fisher Scientific)) with 10% fetal bovine serum (Cytiva) ...
-
bioRxiv - Microbiology 2023Quote: ... Complex medium (YPD) contained 10 g L-1 Bacto yeast extract (Thermo Fisher Scientific, Waltham MA), 20 g L-1 Bacto peptone (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... Immunoprecipitations were performed using 1-2ug of antibody bound to protein A/G magnetic beads (Thermofisher), incubated overnight at 4℃ ...
-
bioRxiv - Molecular Biology 2023Quote: ... were grown in LHC-9+ 1% penicillin G (Pen) and streptomycin (Strep) (serum-free) medium (Gibco) following established protocols under sterile conditions (12) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 mg of cortex lysate supernatant was incubated with 30 μl of Protein G Dynabeads (Invitrogen) preincubated with the appropriate antibodies (the information for antibodies is in Table S2) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... with Dulbecco’s Modified Eagle Medium (DMEM) containing 1 g/L glucose (Gibco, Life Technologies, Burlington, Canada), 10% fetal bovine serum (FBS ...
-
bioRxiv - Synthetic Biology 2024Quote: ... with Dulbecco’s Modified Eagle Medium (DMEM) containing 1 g/L glucose (Gibco, Life Technologies, Burlington, Canada), 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2024Quote: Molten agarose solution was prepared with 10 g l−1 UltraPure™ Agarose (Invitrogen, 16500-100) in MM ...