Labshake search
Citations for Thermo Fisher :
3501 - 3550 of 10000+ citations for 6 Chloropyrazolo 1 5 a pyridine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells were transfected with (pRMB EDEN15) and BASU plasmids (6:1 ratio) using Lipofectamine 2000 (1:1 ratio, Life Technologies, California, USA). 40 hours post-transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... 6 hours prior to collection organoids were incubated with 1 μM EdU (Thermo fisher, #C10636).
-
bioRxiv - Immunology 2019Quote: ... pneumoniae for 6 hours in 1% FCS phenol free alpha MEM (base media, Life Technologies). Cells were washed three times in PBS and gently lifted from the plate using a cell scraper in 300μl of base media supplemented with 1mM EDTA ...
-
bioRxiv - Neuroscience 2022Quote: ... using samples diluted to 1:1000 while interleukin (IL)-6 (Thermo Fisher Scientific, Cat. #BMS625) was evaluated using samples diluted 1:2 ...
-
bioRxiv - Immunology 2022Quote: ... in 6-well plates and cultured in 1 ml/well RPMI-1640 medium (Thermo Fisher) containing 4% B-27 (Life Technologies) ...
-
bioRxiv - Biochemistry 2019Quote: ... Sf9 cells were grown in 1X 10 6 for 1 litre of Sf900 II (Gibco) media in presence of antibiotic and antimycotic (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... Suspension cells (THP-1) were first seeded for 6 h on poly-D-lysine (Gibco)-coated wells before starting the assay ...
-
bioRxiv - Systems Biology 2022Quote: ... with the addition of 6 μl ERCC Spike-In Control Mix 1 (Ambion Thermo Fisher) diluted 1:10,000 ...
-
bioRxiv - Systems Biology 2022Quote: ... with the addition of 6 μl ERCC Spike-In Control Mix 1 (Ambion Thermo Fisher) diluted 1:10,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... Fresh media was added and passaged 1:6 using the StemPro EZpassage tool (Life Technologies) as per the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: ... The GLT-1 encoding sequence was subcloned into pcDNA™6 V5 Myc (Thermo Scientific).
-
bioRxiv - Systems Biology 2023Quote: Approximately 1*10^6 UWB1.289 were lysed in 650 µl Tri reagent (Thermo Fisher, #AM9738) and bead milled with the following settings ...
-
bioRxiv - Molecular Biology 2024Quote: ... arteries were incubated for 6 minutes in collagenase type IV (1 mg/mL, Life Technologies) and porcine pancreatic elastase (1 U/mL ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were blocked in 2% goat serum + 2% Bovine Serum Albumin for 2 hours at room temperature before primary antibody (GFP, 1:500, Invitrogen #A6455) was added and the embryos were incubated overnight at 4°C with rocking ...
-
bioRxiv - Molecular Biology 2020Quote: ... The tryptic peptides were loaded at 5 μL/min onto a C18 trap column (Thermo Scientific, 100 µm ID×2 cm, 5 μm, 120 Å). Peptides were separated with PicoFrit columns (New Objective ...
-
bioRxiv - Systems Biology 2020Quote: ... Disulfide bonds were reduced with 5 mM Tris(2-carboxyethyl)phosphine (TCEP) Bond-breaker (Thermo Scientific) at RT for 1 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... protected by an Acclaim PepMap C18 column (100 μm x 2 cm, 5 μm; Thermo Scientific) before injection into a Q-Exactive mass spectrometer (ThermoFisher) ...
-
bioRxiv - Microbiology 2020Quote: ... The precolumn was a 2 cm EASYcolumn (ID 100 µm, 5 µm particles) (Thermo Fisher Scientific) while the analytical column was a 10 cm EASY-column (ID 75 µm ...
-
bioRxiv - Developmental Biology 2021Quote: ... The eggs were then loaded with the calcium indicator Fura-2 AM (5 μM; Thermo Fisher) for 30 min in KSOM containing 0.02% pluronic F-127 (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... the drinking water contained thymidine analogue EdU (5-ethynyl-2’-deoxyuridine, Thermo Fisher, cat. no: E10415) to label newly-generated cells ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... the Click-iT EdU (5-ethynyl-2’-deoxyuridine) Alexa Fluor (AF) 568 imaging kit (Molecular Probes) was used in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... HEp-2 cells were initially seeded in growth medium (DMEM medium with 5% FBS (ThermoFisher, USA), 1% Penicillin/Streptomycin (ThermoFisher ...
-
bioRxiv - Biochemistry 2019Quote: ... 4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate (DAF-FM DA; Molecular Probes, Eugene, OR, USA) was used to detect NO production in sorghum genotype stalks in response to inoculation treatment at 7 DPI ...
-
bioRxiv - Neuroscience 2020Quote: ... injection of EdU (5-ethynyl-2’-deoxyuridine; Click-it EdU Alexa Fluor 488 imaging kit, Invitrogen) at 5 and 6 days DPD at 50 mg/kg ...
-
bioRxiv - Immunology 2020Quote: ... washed 2 × 100μL with complete RPMI and stained with 5 nM TMRE (T669, Thermo Fisher Scientific) in 200 μL complete RPMI at RT for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primer extension was performed with 2 pmol of DNA gene-specific primers (5’CATGCTTAACGTAATTCAACAGAAATTATATG) by Invitrogen SuperScript III reverse transcriptase ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR detection of SARS-CoV-2 was performed on a QuantStudio 5 instrument (Applied Biosystems) using a TaqPath 1-step RT-qPCR Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: TbPolN RNAi cells were incubated with 150 µM of 5-ethynil-2’-deoxyuridine (EdU; Life Technologies) for 4 hrs at 37 °C with 5% CO2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5×107 mESCs were resuspended in PBS and crosslinked in 2 mM disuccinimidyl glutarate (Thermo Scientific) for 45 min at 25°C with gentle rotation ...
-
bioRxiv - Cancer Biology 2019Quote: Cells were labelled with 10 μM 5-bromo-2′-deoxyuridine (BrdU) (Thermo Fisher Scientific, Cat. #: B23151) for 30 min ...
-
bioRxiv - Zoology 2020Quote: ... After 2 h and 30 min we added 5 μM dihydrorhodamine-123 (DHR) (Thermo Fisher Scientific) to the cell suspension to stain cells positive for reactive oxygen species (ROS ...
-
bioRxiv - Genomics 2021Quote: ... followed by 2 x 5 min washes in PBS before mounting in Prolong Diamond (Life Technologies).
-
bioRxiv - Immunology 2020Quote: T cells (5×106) from triplicates of 2 independent experiments were lysed in TRIzol reagent (ThermoFisher). Total RNA was isolated per manufacturer’s instruction and resuspended in RNase free water ...
-
bioRxiv - Immunology 2020Quote: Mice were injected intraperitoneally with 0.5 mg 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen or Sigma-Aldrich). For pulse experiments ...
-
bioRxiv - Cell Biology 2022Quote: 200,000 cardiomyocytes were incubated in Amplex Red (5 μM; 2 min) for cellular ROS (A22177, ThermoFisher), or MitoSOX Red (5 μM ...
-
bioRxiv - Bioengineering 2022Quote: ... RBC (5 million cells/mL) were incubated with 2 μg/mL calcein AM (Thermo Fisher Scientific) for 15 minutes at 37°C ...
-
bioRxiv - Physiology 2024Quote: Mice were given intraperitoneal injection of 25 mg/kg of EdU (5-ethynyl-2’-deoxyuridine, Invitrogen) dissolved in 1x PBS on Day 13 of knockout ...
-
bioRxiv - Developmental Biology 2023Quote: ... mice were injected intraperitoneally with 2.5 mg of 5-ethynyl- 2’-deoxyuridine (EdU; Thermo Fisher Scientific). Lungs were harvested ...
-
bioRxiv - Genomics 2023Quote: ... for 2 h and with 33 nM C12FDG (5-Dodecanoylaminofluorescein Di-β-D-Galactopyranoside; ThermoFisher D2893) for 1 h ...
-
bioRxiv - Developmental Biology 2023Quote: The medusae were incubated with 150 μM 5-ethynyl-2’-deoxyuridine (EdU) (EdU kit; Invitrogen, C10337) in ASW for 1 h or 24 h ...
-
bioRxiv - Cell Biology 2023Quote: ... TMT reaction was allowed for 2 hours and quenched with 5% hydroxylamine (90115, Thermo Fisher Scientific). All the samples were pooled and dried in a SpeedVac (EP022822993 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of sgRNA plasmid was transfected to PLC/PRF/5 cells using Lipofectamine 3000 (Invitrogen). After 2 days’ culture in DMEM medium ...
-
bioRxiv - Bioengineering 2023Quote: A 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay was performed according to the manufacturer’s protocol (Invitrogen). Briefly ...
-
bioRxiv - Genetics 2023Quote: RNA was extracted from 2-5 million HEK293T or U937 cells using TRIzol Reagent (Ambion, 15596018). Genomic DNA was removed using DNA-free DNA removal Kit (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... The tissue was incubated 2 times in RPMI 1640/5%FCS supplemented with 5mM EDTA (Gibco) for 20min each at 37°C and 200rpm ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... per liter] and 20% glycerol on an SM/5 agar media [2 g glucose (Fisher Scientific), 2 g yeast extract (Oxoid) ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were trapped (PepMap 100 C18, 100 μm × 2 cm, 5 μM particles; Thermo Fisher Scientific) at a flow of 5 µL min-1 of 0.1 % FA ...
-
bioRxiv - Immunology 2023Quote: ... pre-coated (5 μg cm−2) 4-well chamber slide (Thermo Fisher Scientific, cat. no. 154526). A fluorescence image was captured using an LSM 880 confocal microscope (Carl Zeiss AG ...
-
bioRxiv - Immunology 2023Quote: ... added to 2 μL of TruCut Cas9 Protein v2 (5 ng/μL, Thermo Fisher Scientific A36498), and incubated for 10 minutes at room temperature ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... per liter] and 20% glycerol on an SM/5 agar media [2 g glucose (Fisher Scientific), 2 g yeast extract (Oxoid) ...