Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... diluted 1:5 in Neurobasal (Gibco) and grown for 5 days in the following medium ...
-
bioRxiv - Neuroscience 2024Quote: ... TAU-5 (ThermoFisher, AHB0042, 1:2000), and α-tubulin (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... + 1% FCS + 5 mM EDTA (Gibco)) and incubated with 5μl TruStain FcX receptor blocking solution (Biolegend ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
bioRxiv - Cell Biology 2024Quote: ... a premium microscope slide (Fisher-finest, 3″ × 1″ × 1 mm; Thermo Fisher Scientific, 12-544-1) or chambered coverglass (1 well ...
-
bioRxiv - Microbiology 2020Quote: ... Fluorescent stains (TOTO-1 iodide; 1 μM, Life Technologies, and ethidium homodimer-2 (EthHD-2); 1 μM ...
-
bioRxiv - Microbiology 2020Quote: ... and probe E_Sarbeco_P1 (5′-FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ-3′) using the TaqPath 1-Step Multiplex Master Mix kit (Applied Biosystems) on a QuantStudio 5 real-time PCR system (Appiled Biosystems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.125 μM Oligo-dT30VN (IDT, 5’AGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Neuroscience 2021Quote: ... a staining solution of 1 mg/mL 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal, Invitrogen), 1× citratesodium phosphate buffer (pH 6.0) ...
-
bioRxiv - Neuroscience 2021Quote: ... slides were washed in 3×5’ PBS and incubated in goat-α-rabbit-555 (1:1000, Life Technologies, A21207) in PBS for 90’ ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were washed in 0.1 M TB (3 ×5 minutes) and then incubated in goat anti-chicken Alexa 488 (1:1000, #A11039, Invitrogen), goat anti-rabbit Alexa 568 (1:500 to 1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3.125 µM Oligo-dT30VN (IDT, 5′-AAGCAGTGGTATCAACGCAGAGTACT30VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Immunology 2023Quote: ... Following preset incubation times (0, 0.5, 1, 3, or 5 h) cells were harvested by trypsinization (500 μl TrypLE, Gibco) for 5 min at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... animals were incubated for 5 min in TO-PRO-3 Iodide (642/661) (Invitrogen, cat#T3605, 1:1000 dilution). And last ...
-
bioRxiv - Neuroscience 2024Quote: ... washed 3 x 5 min in PBS at RT and then incubated with Hoechst 33342 (1:5000, Invitrogen, H3570) in PBS for 30 min at RT ...
-
bioRxiv - Neuroscience 2021Quote: ... in Tris-buffered PBS/ 0.1 % Tween 20 for 1 h at room temperature they were incubated overnight at 4 °C with the following antibodies: rabbit polyclonal anti-2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase; 49 kDa; 1:1000; Thermo Fisher Scientific, Waltham, MA, USA), mouse monoclonal anti-myelin-associated glycoprotein (MAG ...
-
bioRxiv - Physiology 2020Quote: ... The membrane was probed with primary antibodies for α-Tubulin (ThermoFisher 322588, clone B-5-1-2), acetylated (Sigma T7451 ...
-
bioRxiv - Developmental Biology 2024Quote: ... was prepared and added to 426.5 μL 2:1 (vol:vol) 0.1x Tris (Fisher Scientific, cat.# BP152-5)-ethylenediaminetetraacetic acid (EDTA ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclei were stained for 5 minutes with 1 µM 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen), coverslips were mounted on glass slides with mounting medium (Dako) ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 µL mL-1 egg lecithin (5 mM in EtOH) and 1x chemical defined lipid concentrate (Gibco). After incubation for 2 days ...
-
bioRxiv - Plant Biology 2024Quote: ... was amplified by the primers (5’-CACCATATTAATGTTTCGATCATCAGAATC-3’ and 5’-TTCGATAGTGTTGGATTATATAGGG-3’) and cloned into the pENTR 5’-TOPO (Invitrogen) (51) ...
-
Hepatic iNKT cells facilitate colorectal cancer metastasis by inducing a fibrotic niche in the liverbioRxiv - Immunology 2024Quote: ... 1% N-2 and 2% B-27 supplements (Gibco). MC38 cells were cultured in DMEM (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... we changed the medium to a 1:1 mixture of KSR and N2B medium (DMEM F12, Thermo Fisher 11320033, with 1% GlutaMAX, 3% dextrose, N2-Supplement B, StemCell Technologies 07156, 5 μg/mL puromycin, Life Technologies A11138-03, and 2 μg/mL doxycycline). On day three ...
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and (MtWOX5) 5’-CACCATGCAGACGGTCCGAGATCTGTC-3’ and 5’- CCTTCGCTTAAGTTTCATGTAA-3’ (AhWOX5) and cloned into pENTR-dTOPO (Invitrogen). The entry clones of AhWOX5 & MtWOX5 recombined through LR clonase Gateway technology (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... siM1-4: 5’ -ACTGGTAGCTTATTAAAGATT- 3’) and the HOXA1 siRNA (5’ - AGAACTTCAGTGCGCCTTATT- 3’) were purchased from Invitrogen™ (Silencer® Select siRNA ...
-
bioRxiv - Microbiology 2024Quote: ... This was followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for about 10 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Target mtDNA gene (Forward primer: 5′-CACCCAAGAACAGGGTTTGT-3′, Reverse primer: 5′-TGGCCATGGGTATGTTGTTAA-3′, Invitrogen custom primers) and reference 18S ribosomal RNA gene (Forward primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 µg isolated RNA were digested with 5 µl DNase I (1 U µl-1, Thermo Scientific) for 40 min at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... 5×10-5 M 2-mercaptoethanol (Gibco) and 50µg/mL Gentamicin (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Cell Biology 2022Quote: ... 3 ml was diluted 1:1 with PBS (Thermo Fisher Scientific, Waltham, MA) and kept on ice for purity analysis by flow cytometry ...
-
bioRxiv - Plant Biology 2022Quote: ... The seedlings were screened by microscopy for YFP and then fixed and processed for immunofluorescence microscopy using a 1:2000 dilution of monoclonal anti-α-tubulin B-5-1-2 antibody (Life Technologies; 32-2500) followed by 1:2000 dilution of Alexa-568 goat anti-mouse antibody (Thermo Fisher ...
-
bioRxiv - Neuroscience 2022Quote: ... 5’-AAAGCTCGAGCTCTACAAATGTGGTATGGCTG-3’ (Thermo Fisher Scientific). PCR products were purified (Monarch PCR Cleanup Kit (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5’-UAGCGACUAAACACAUCAA-3’ (Thermo Fisher Scientific); RNF168 siRNA #1,siGENOME Smartpool Dharmacon (Cat# M-007152-03) ...
-
bioRxiv - Physiology 2020Quote: ... 5’-UUGAUUUGCUGAGAAGGAC-3’ (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... siRNA#4: 5’-AUAGCGUUUCUUCUAACUGGGCAGC-3’ (Invitrogen). siRNAs #2 and #4 significantly decreased the mRNA levels to the greatest extent and both had the same mitotic phenotypes ...
-
bioRxiv - Genomics 2024Quote: ... 5-(3-aminoallyl)-dUTP (Invitrogen, AM8439); BSPEG9 (thermofisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TO-PRO-3 (1:3000; Thermo Fisher) for fluorescent labelling of living and dead cells (‘Imaging medium’) ...
-
bioRxiv - Genetics 2021Quote: ... 8ul of 1:3 Vectashield (Thermo Fisher Scientific) DAPI:PBS was added to samples and allowed to incubate for 5 min ...
-
bioRxiv - Biophysics 2021Quote: ... 1× 10−3 М glutamine (Gibco, Cat:25030149) and 2 mg/ml gentamicin (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... in 1:3 ratio using lipofectamine (Life Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TO-PRO-3 (Thermo Fisher T3605, 1:10,000) to label dead cells ...
-
bioRxiv - Neuroscience 2021Quote: ... the DNA dye TOPRO-3 (1:1000, Invitrogen), diluted in a blocking buffer for 2 h at 24 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... pan-cytokeratin (ThermoFisher, 3-9003-82, 1/50), pSmad1/5/8 (Merck ...
-
bioRxiv - Molecular Biology 2022Quote: ... then washed 3 times with 1×PBS (Invitrogen). Roots were then squashed under coverslips onto slides that had been pre-treated with 3-Aminopropylthiethoxysilane (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 3) donkey anti-rabbit 488 (1:250, Invitrogen). To visualize immunofluorescence ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-V5 (Invitrogen, #R96025, 1:800, 3 days), anti-cFOS (Abcam ...
-
bioRxiv - Immunology 2024Quote: ... rabbit anti-caspase 3 (710431, Invitrogen, 1:100), rabbit anti-PDL1 (GTx57193 ...
-
bioRxiv - Genetics 2020Quote: ... Cells were seeded in 6-well plates and transfected with 4 μg/well vectors expressing CasRx-GFP and gRNAs-mCherry (CasRx:gRNA-1:gRNA-2 = 2:1:1, see Supplementary sequences) using Lipofectamine 3000 reagent (Thermo Fisher Scientific). Control group was only transfected with 2 μg/well vectors containing CasRx-GFP ...