Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Slides were then incubated for 1 hour in 2-3 drops per slide of HRP-conjugated streptavidin (Alexa Fluor 594 Tyramide Superboost Kit, Invitrogen), washed 3 times for 10 minutes each in 1x PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 minutes prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Genetics 2023Quote: ... 3-5 million cells or approximately 15 ug of DNA crosslinked with 2% PFA (Fisher Scientific F79-500) were used as input per reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 min prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-3 µL of 5 µM protein solution was introduced directly into Q-Exactive UHMR mass spectrometer (ThermoFisher) through gold coated capillary needles that were prepared in-house30 ...
-
bioRxiv - Physiology 2023Quote: ... cells were incubated with fresh DMEM containing DDAO galactoside (9H-(1,3-dichloro-9,9-dimethylacridin-2-one-7-yl) β-D-Galactopyranoside) (Molecular Probes™) for 2 hours ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The pbf1 gene of johansen Standard was amplified with the primer pair psbNRO_F 5’-AGCATTGGGAGGCTCATTAC-3’ and psbNRO_R 5’-GGAAACAGCAACCCTAGTCG-3’ and cloned into to pCRTM2.1-TOPO® (Invitrogen). The vector was linearized with HindIII and in vitro transcription was performed according to the suppliers’ protocol ...
-
bioRxiv - Microbiology 2020Quote: ... RdRp_rev 5’-CAAATGTTAAAAACACTATTAGCATA-3’ RdRp_probe 5’-FAM-CAGGTGGAACCTCATCAGGAGATGC-TAMRA-3’) and/or TaqMan gene expression assays (Applied Biosystems) for ACTB (Hs99999903_m1) ...
-
bioRxiv - Immunology 2022Quote: ... and their corresponding FAM-labelled MGB probes (εGLT: 5′-AGGCACCAAATG-3′ and γ1GLT: 5 ′-CTCAGCCAGGACCAAG-3′) (Applied Biosystems) were designed in house ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’- CCACCCTCCAGCCAATC-3’ and FAM/ZEN-labeled probe 5’-ACAGGGCAACCATTGGCTCG-3’ with Taqman Gene Expression Master Mix (ThermoFisher).
-
bioRxiv - Microbiology 2023Quote: The embB region containing codon 406 was amplified using PCR primers F1 5’-TGATATTCGGCTTCCTGCTC-3’ and R1 5’-TGCACACCCAGTGTGAATG-3’ designed using Primer3 (23) (version 0.4.0) and acquired from ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... epidermidis (Thermo scientific; 3 μg/ ml in 1% BSA). MSC’s were labelled with anti-vimentin monoclonal antibody (Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1.1ul (4U) FastDigest-HindIII (prediluted 1/3) (Thermo Fisher) and 11.1ul 20X primer-probe mix ...
-
bioRxiv - Biophysics 2021Quote: ... Mirius (1:3) in Opti-MEM media (Thermo scientific). Cell confluency was allowed to reach 70-80% prior to transfection ...
-
bioRxiv - Bioengineering 2021Quote: ... or rabbit anti-caspase-3 (1:500, ThermoFisher #700182) followed by Alexa-conjugated anti-mouse or anti-rabbit secondary antibodies for 8 hours each at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... or (3) 1:20 AlexaFluor 647 phalloidin (ThermoFisher #A22287) (Figure S2F ...
-
bioRxiv - Cell Biology 2021Quote: ... in a 1:3 ratio using lipofectamine (Life Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... in a 1:3 ratio using lipofectamine (Life Technologies) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... PBS containing 1 µM TO-PRO 3 (Thermo Scientific) was applied to each section followed by 3 washes with PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... with TO-PRO-3 (#T3605, ThermoFisher, 1:1000 dilution).
-
bioRxiv - Neuroscience 2021Quote: ... 1-hexanol (99%, ACROS Organics, CAS 111-27-3), 2-oxovaleric acid (>98% ...
-
bioRxiv - Microbiology 2021Quote: ... 3-cholamidopropyl dimethylammonio 1-propanesulfonate (CHAPS; zwitterionic; Thermo Scientific). In addition ...
-
bioRxiv - Developmental Biology 2022Quote: IF blocking buffer: 1/3 Blocker Casein (ThermoFisher 37528), 2/3 HEPM with 0.05% Triton X-100
-
bioRxiv - Molecular Biology 2021Quote: ... containing 1 M sodium chloride (S671-3, Fisher Scientific). The labelling protocol was carried out at pH 7.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-Neuroligin-3 (1:1000, Thermo Fisher Scientific), rabbit anti-COX-2 (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and TO-PRO-3 (1:10,000, Thermo Fisher Scientific). Images were taken using a 20x oil immersion and a 10x dry objective on a Leica TCS SP8 confocal microscope.
-
bioRxiv - Developmental Biology 2023Quote: ... Immunofluorescence blocking solution: 1/3 Blocker Casein (ThermoFisher Scientific), 2/3 HEPM with 0.05% TX-100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and benzonase (1:100, Fisher Scientific, 70-664-3) on ice for 30 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cleaved Caspase-3 (Asp175) (1:200, Invitrogen PA5-114687), Tom20 (1:400 ...
-
bioRxiv - Microbiology 2024Quote: ... 1% P/S and 3 μg/ml puromycin (Gibco). Human foreskin fibroblasts (HFFs ...
-
bioRxiv - Neuroscience 2024Quote: ... 8) anti-GFAP (1/250) (Thermofisher scientific, 3-0300), 9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... or TO-PRO-3 Stain (1 µM, ThermoFisher Scientific). Flow cytometry was performed on either an LSRII ...
-
bioRxiv - Neuroscience 2020Quote: ... tissues were washed in PBS (3×5 min) and incubated with secondary antibodies conjugated to Alexa Fluor 488 (1:400; goat anti–rabbit; Life Technologies) or Alexa Fluor 594 (1:400 ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5 µl of 3 ng µl-1 cDNA was used as template in the QuantStudio 5 Real-Time PCR system (Applied Biosystems). Amplifications were performed with 5 μl of SYBR® green JumpStart Taq ReadyMix (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slices were then washed in PBS (3 × 10 min) followed by a 5 min incubation with DAPI (Thermofisher Scientific, 1: 5000) diluted in PBS ...
-
bioRxiv - Immunology 2020Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5′AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Developmental Biology 2022Quote: ... with cDNA (diluted 1:5) and gene-specific primers (Key Resources Table) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) in triplicate ...
-
bioRxiv - Evolutionary Biology 2021Quote: For ethanol preference assays, experimental substrates were 1% agarose and contained 75mM sucrose and increasing concentrations (3%, 5%, and 7%) of ethanol (ThermoFisher #BP2818); control substrates were 1% agarose and contained 75mM sucrose.
-
bioRxiv - Cell Biology 2021Quote: ... Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200, Life Technologies) diluted in 10% FBS for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 μM 6-JOE-conjugated reverse primer (5’-6-JOE-GATGATCTCCACCTTGCCGT-3’) was extended with 1 pmol of RNA as template using Superscript III (Thermo Fisher) as reverse transcriptase ...
-
bioRxiv - Genetics 2023Quote: ... Ovaries were washed 3 times for 5 min with PBTx before incubation at room temperature in 1 μg/mL DAPI (Invitrogen, ThermoFisher Scientific) solution in PBS for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GAGACCCUAUCCGUGAUUAtt-3’ and antisense: 5’- UAAUCACGGAUAGGGUCUCtt-3’ (Silencer Select, rat negative control #1; scrambled siRNA and all siRNAs were from Ambion, Life Technologies). Transfection complexes were prepared in accordance with the instructions provided by the manufacturer and added to 2×105 cells seeded per well in 24-well plates.
-
bioRxiv - Bioengineering 2024Quote: ... and incubated for 3-5 minutes at 37°C with a 1:10 dilution of trypsin 2.5% (Thermo Fisher #15090-046) in PBS (HSCs ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse calvariae were dissected from 1–3 days old neonatal mice and digested sequentially 5 times for 25 minutes in α-MEM (Gibco) containing 0.1% collagenase (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... membrane was washed 3 x 5 min in PBS-T and incubated for 1 hour at RT with secondary antibody anti-mouse (Invitrogen #31439) or anti-rabbit (Invitrogen #31460 ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 ng/mL recombinant murine interleukin-3 (IL-3) (Gibco). Cells were grown in a humidified incubator at 37 °C and 6% atmospheric CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP7 siRNA: 5’-GCAACACUUAGAAGGAGAAGGCCUA-3’ (1362318, Invitrogen); GTPBP8 siRNA#1 ...
-
bioRxiv - Cell Biology 2023Quote: DCAF5 5‘-GCAGAAACCUCUACAAGAAdTdT-3’ (Ambion, silencer select)
-
bioRxiv - Cell Biology 2024Quote: ... Rab11b - 5’-CUAACGUAGAGGAAGCAUUtt-3’ (Ambion, USA #4390824); Rab35 - 5’-GCAGUUUACUGUUGCGUUUtt-3’ (Ambion ...