Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged every 2-3 days with 1:4-1:6 ratio by incubation cells with 0.5 mM EDTA (Fisher Scientific MT-46034CI) for 5 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-phosphohistone 3 (1:100, Invitrogen), anti-phosphoAMPK (1:200 ...
-
bioRxiv - Neuroscience 2020Quote: ... TOTO-3 iodide (1/2000, Invitrogen) was added to the secondary antibody solution to label cell nuclei (Invitrogen) ...
-
bioRxiv - Genetics 2021Quote: ... 1/3 Neurobasal (Thermo Fisher Scientific), 1x N-2 Supplement (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... or ToPro-3 (1:1000, Invitrogen) added to the third wash to stain nuclei ...
-
bioRxiv - Bioengineering 2022Quote: ... 1% N-2 (Thermofisher), 2% B-27 (Thermofisher ...
-
bioRxiv - Microbiology 2023Quote: ... 1× N-2 (Gibco), 50 ng/ml of mouse EGF (RnD) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1% N-2 (Gibco), 2% B-27™ (Gibco) ...
-
bioRxiv - Synthetic Biology 2021Quote: N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine triethylammonium salt (NBD-PE) was supplied by Thermo Fisher Scientific Inc ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by transfer to a positively charged nylon membrane and then crosslinked with EDC (1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide) at 60°C for 1–2 hours and prehybridized with ULTRAhyb Ultrasensitive Hybridization Buffer (Invitrogen, cat # AM8670). The membrane was then hybridized with 50 pmol mL−1 Biotin-labeled Locked Nucleic Acid-modified DNA probes (designed and synthesized by Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ml l1 glycerol and 20 g l−1 Bacto agar) supplemented with 25 µg ml−1 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, Thermo Fisher Scientific). Overnight cultures of the control strains were normalized to OD600 = 1.0 and inoculated as 20 µl spots on the agar plates containing the biosensor ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked for 1 hour in 5 % normal donkey serum in 3% PBST and then incubated in chicken anti-GFP (Invitrogen, A10262, 1:1000) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... The medium was changed every 2-3 days and organoids were passaged every 2-4 weeks by dissociation with 1 ml of TrypLE Express (Life Technologies) at 37°C for 5 min ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM DTT, 50 mM HEPES, 3 mM MgCl2, 2 mM PMSF, 1 PierceTM protease inhibitor mini tablet/2 L; Thermo Scientific), sonicated ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Cell Biology 2021Quote: ... Mouse ENKD1 shRNA (nucleotides targeting 403-423 bp, 5′-CGCTCACCCAAGTATGACAAT-3′) were cloned into pLKO.1 (Invitrogen).
-
bioRxiv - Molecular Biology 2022Quote: ... medium (1:1) supplemented with N-2 (Gibco), B-27 (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... claudin-5 (1 μg/ml) and occludin (2 μg/ml; all from Thermo Fisher Scientific). After incubation with primary antibodies membrane was washed with PBS-T three times on a platform rocker and incubated with horseradish peroxidase-conjugated secondary antibody diluted in PBS-T 1:2000 (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recovered nuclei were stained with FITC-conujugated α-5-bromo-2’-deoxyurine (Invitrogen, MoBu-1) in staining buffer (2 mM HEPES pH 7.4 ...
-
bioRxiv - Developmental Biology 2023Quote: Tadpoles were immersed in a solution containing 1 mM EdU (5-ethynyl-2’-deoxyuridine; Invitrogen) before fixation ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Microbiology 2022Quote: ... 1 ml phenol:chloroform 5:1 pH 4.5 (Thermofisher #AM9720) and 0.5 ml glass beads (Sigma #G8772) ...
-
bioRxiv - Bioengineering 2023Quote: ... The concentrated virus was diluted 1:5 in hepatocyte medium containing N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid buffer (HEPES; 20 mM; Gibco) and 4 μm/mL polybrene (Sigma ...
-
bioRxiv - Biophysics 2024Quote: ... were seeded in a 6-well culture plate at a concentration of 2 x 105 cells ml-1 (2 ml per well in DMEM (Nissui) supplemented with 5 % fetal bovine serum (Gibco), glutamine ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO-2/3 (Invitrogen); β-Catenin (BD Transduction Laboratories) ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was allowed to proceed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Biophysics 2022Quote: ... 19 mg EDC (1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide) (Thermo Fisher), 11 mg sulfo-NHS (N-Hydroxysulfosuccinimide ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % dipalmitoyl PI(3)phosphate (PI(3)P diC16) (Life Technologies) and extruded to 400 nm using a polycarbonate filter and a hand extruder (Avanti Polar Lipids ...
-
bioRxiv - Bioengineering 2023Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was performed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Bioengineering 2024Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Thermo Scientific, 22980) were added to the alginate solution in a molar ratio of 1 alginate:30 NHS:25 EDC ...
-
bioRxiv - Neuroscience 2022Quote: BDA was visualized with fluorophore-conjugated streptavidin (Thermo Fisher Scientific, Table 2; 1:1,000 for 3 h). The reaction was enhanced using the biotinylated tyramine (BT)-glucose oxidase (GO ...
-
bioRxiv - Microbiology 2022Quote: Anti-ORF8 mAb (#1-3-2) was coupled to aldehyde/sulfate latex beads (Thermo Fisher Scientific A37304). The antibody was mixed with the latex beads and shaken at room temperature overnight ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 mM DTT, 50 mM HEPES, 3 mM MgCl2, 2 mM PMSF, 1 Pierce™ protease inhibitor mini tablet/2 L; Thermo Scientific). The lysate was sonicated then incubated with 500 units/1 L culture Benzonase Nuclease (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Cell Biology 2023Quote: ... HSPCs were incubated with 20µM NBD C6-Ceramide (6-((N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)amino)hexanoyl)Sphingosine) (Invitrogen) for 30 minutes at 4°C for Golgi staining or Cytopainter (Abcam ...
-
bioRxiv - Immunology 2024Quote: Sort-purified cells (∼1-5×106) were cross-linked for 10 min in 1 ml of 2% methanol-free formaldehyde (Thermo Fisher Scientific) in PBS + 3% BSA ...
-
bioRxiv - Cancer Biology 2024Quote: ... EDTA was added to the samples at a final concentration of 5 mM and the suspension was diluted 1:5 in collection buffer (2 % heat-inactivated fetal bovine serum, Life Technologies; 26140079 ...
-
bioRxiv - Cell Biology 2023Quote: ... siCT (5’- CGUACGCGGAAUACUUCGAtt-3’, Ambion), siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-5 μL RNAiMAX (Invitrogen) were added to 500 uL serum-free RPMI-1640 and incubated at room temperature for 5 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were washed 3 x 5 min and incubated for 10 min with DAPI (1/2000, Invitrogen #D1306) diluted in PBT + 0.5% BSA ...
-
bioRxiv - Microbiology 2022Quote: ... Vero-E6 cells and Calu-3 were treated with 5 μg/ml or 1 μg/ml puromycin (Gibco), respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... Iba-1 (1:1000, Wako) and COX-2 (1:1000, Thermo Fisher) at 4°C overnight ...