Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-aagaattggagggaccaccccc-3’ (underline is the codon change T to R) and 5-tgtcacgcgctcaaagtggttg-3’ using the fusion DNA polymerase (Thermofisher). After treating the PCR products with DpnI (New England Biolabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... To-Pro-3 (1:500, Invitrogen T3605). Secondary antibodies were obtained from Jackson ImmunoResearch or Invitrogen and used at 1:200.
-
bioRxiv - Biochemistry 2022Quote: ... 3) 1% Pluronic-127 (cat. # P6866, ThermoFisher) in BRB80 ...
-
bioRxiv - Systems Biology 2022Quote: ... diluted 1:3 with DPBS (Life Technologies) and 25μL added to the wells ...
-
bioRxiv - Bioengineering 2021Quote: ... + 1 × 10−3 M sodium pyruvate (Gibco) + 0.05 × 10−3 M 2-mercaptoethanol (Sigma)] supplemented with soluble anti-mouse CD28 (5 µg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... and Toto-3 (1:1000; Thermo Fisher) as nuclear counterstain.
-
bioRxiv - Developmental Biology 2023Quote: ... or TO-PRO-3 (1:50000, ThermoFisher) for 1 hour at room temperature or overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... claudin-3 (1:200; Thermo Fisher Scientific), claudin-15 (1:200 ...
-
bioRxiv - Cancer Biology 2023Quote: ... proteinase K (3 μg ml−1; ThermoFisher) digestion ...
-
bioRxiv - Genetics 2023Quote: ... diluted 1:3 in 1X PBS (Gibco). Trypsin was inactivated by cell media.
-
bioRxiv - Cancer Biology 2024Quote: ... 3% H2O2 (Fisher Scientific 7722-84-1) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1-3 L of Expi293F cells (ThermoFisher) were grown at 37°C to a cell density of 3.2×106 cells/mL in FreeStyle expression medium (ThermoFisher) ...
-
bioRxiv - Immunology 2022Quote: ... ICOS-SB436 (ISA-3, Invitrogen, 1:50), IgG-BV480 (goat polyclonal ...
-
bioRxiv - Cell Biology 2024Quote: ... Lipofectamine RNAiMAX (Thermo Scientific, 13778030, 1:3), FuGene HD (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... PV-3 SC8 VLPs or infectious PV-1 were incubated with 5 µM SYTO9 (Thermo Fisher) and SYPRO red (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: shRNAs targeting TRIM37 (TRIM37-1, 5’-tcgagaatatgatgctgtg-3’) were cloned into the pGIPz (Thermo Fisher Scientific) vector ...
-
bioRxiv - Physiology 2022Quote: ... The nucleic acids present in the pituitary gland cells were visualised with TOTO-3 (1:2000, Thermo Fisher Scientific). Sections were incubated with TOTO-3 for 15 min on an agitated surface ...
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Microbiology 2020Quote: Treated and untreated biofilm-containing pegs after a 24-hour incubation in MMBC-3 were subjected to microscopic imaging after staining with 5 μM of Syto®9 green-fluorescent nucleic acid stain (Invitrogen, ThermoFisher Scientific) diluted in PBS ...
-
bioRxiv - Biochemistry 2024Quote: hSSB1 and INTS3 proteins were labeled using AF647 dye (Alexa Fluor 647 carboxylic acid succinimidyl ester, Thermo Fisher). The storage buffer was exchanged by dialysis to labeling buffer containing 50 mM MES pH 6.5 ...
-
bioRxiv - Cell Biology 2024Quote: For pull-down of p21-GFP recombinant GFP nanobody VHH4 39,40 was crosslinked to carboxylic acids beads (Invitrogen) according to the manufacturer’s instructions (GFP-Binder beads) ...
-
bioRxiv - Cell Biology 2020Quote: ... CDC20 was depleted using siRNA oligo #14 5’-CGGAAGACCUGCCGUUACA-3’ (ThermoFisher). siRNA oligos for PP2A-B55 and PP2A-B56 have been described (Hayward et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-5 × 105 cells were settled on Polysine Slides (Thermo Fisher), fixed with 4% ...
-
bioRxiv - Neuroscience 2020Quote: ... FIVNC-555p (5’-FAM-CATGGCCACATTAATAATGG CGCA -TAMRA-3’ (Applied Biosystems, CA). These reactions were performed with a Bio-Rad iCyclerTM iQ and analyzed using the manufacturer’s software ...
-
bioRxiv - Cell Biology 2022Quote: ... DLP1-sense strand: 5’-UCCGUGAUGAGUAUGCUUUdTdT-3’ 31 (Ambion, Austin, TX, USA).
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against MyoVa was obtained from Invitrogen (s9207, 5’ GUAUAGUCCUAGUAGCUA 3’) as this was shown to work well by Wu et al (2018) ...
-
bioRxiv - Immunology 2020Quote: ... Reactions were run on a Quantstudio 3 or 5 instrument (ThermoFisher). Cycling conditions for Quantifast reagents were ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using TryplE (Gibco 12604054). Naïve and primed hPSCs were expanded and induced into different lineages in a 5% CO2 incubator at 5% O2 at 37C.
-
bioRxiv - Neuroscience 2023Quote: ... or CRMP2 siRNA (5′ GTAAACTCCTTCCTCGTGT-3′; obtained from Thermo Fisher Scientific) using the 4D-Nucleofector (P3 Primary Cell Solution ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5’- TTGGATCAGCTCAGACATATT-3’ or a nonspecific “scrambled” control (Invitrogen, United States). 72 hours after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 days after transfection by 5 µl of lipofectamine 2000 (Invitrogen) with 2 µg of the plasmid and regularly re-sorted to maintain expression of myr/palm-mCherry.
-
bioRxiv - Cell Biology 2024Quote: ... The siRNA oligonucleotide targeting RIF1 sequence (Invitrogen; Sense: 5’-GAAUGAGCCCCUAGGGAAATT-3’) 138 was used ...
-
bioRxiv - Microbiology 2023Quote: ... Tris(hydroxymethyl)methyl-3-amino propane sulfonic acid (TAPS) was purchased from Acros Organics. Mal-PEG ...
-
bioRxiv - Cell Biology 2022Quote: ... while 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine-5,5′-disulfonic acid (DilC18) was purchased from Invitrogen. All stock solutions were prepared in chloroform/methanol (2:1 ...
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
bioRxiv - Neuroscience 2024Quote: Worms were exposed to 20 mM DL-3-hydroxybutyric acid sodium salt (Acros Organics) on NGM agar plates seeded with E ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... ToPro-3 1:1000 and TMRM 1:100,000 (Invitrogen) added and incubated for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... and 1:1 3-methyl-1-butanol (Thermo Fisher Scientific) in mineral oil were used as cues ...
-
bioRxiv - Genomics 2021Quote: ... and then blocked for 1 hour with 1 ml of blocking buffer (wash buffer containing 3% fatty acid free BSA (Thermo Fisher, 126609)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 mL acid phenol: chloroform 5: 1 (Ambion), and 50 mL 0.5 mm zirconia/silica beads (BioSpec) ...
-
bioRxiv - Genomics 2024Quote: ... 350µL Acid Phenol:chloroform (5:1; ThermoFisher cat# AM9720), and 350µL NETS (300mM NaCl ...
-
bioRxiv - Genetics 2024Quote: ... 400 µL acid phenol: chloroform 5: 1 (Ambion) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... N-hydroxysulfosuccinimide (sulfo-NHS) and 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) from Thermo Scientific were dissolved in 18 MOhm DDW immediately before use ...
-
bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-(−3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) was purchased from Fisher Scientific (Pittsburgh, PA, USA). 2-Bromo-2-methylpropionic acid (BMPA) ...