Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... 200 nM MCPH1-5’-CUCUCUGUGUGAAGCACCUdTdT-3’) in serum-Free Opti-MEM medium (Gibco). The transfection controls were set up as above but without adding the siRNA oligos ...
-
bioRxiv - Microbiology 2024Quote: ... 5’-TATTGGTCTCAGGGAGCGAAAGCAGG 3’ using Superscript III according to the manufacturer’s protocol (Invitrogen, #18080400).68 PCRs were performed to amplify and append partial Illumina i5 and i7 adapter sequences across four sub-amplifications of each library to sequence the entire vRNA genome ...
-
bioRxiv - Microbiology 2020Quote: ... epidermidis (Thermo scientific; 3 μg/ ml in 1% BSA). MSC’s were labelled with anti-vimentin monoclonal antibody (Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1.1ul (4U) FastDigest-HindIII (prediluted 1/3) (Thermo Fisher) and 11.1ul 20X primer-probe mix ...
-
bioRxiv - Biophysics 2021Quote: ... Mirius (1:3) in Opti-MEM media (Thermo scientific). Cell confluency was allowed to reach 70-80% prior to transfection ...
-
bioRxiv - Bioengineering 2021Quote: ... or rabbit anti-caspase-3 (1:500, ThermoFisher #700182) followed by Alexa-conjugated anti-mouse or anti-rabbit secondary antibodies for 8 hours each at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... or (3) 1:20 AlexaFluor 647 phalloidin (ThermoFisher #A22287) (Figure S2F ...
-
bioRxiv - Cell Biology 2021Quote: ... in a 1:3 ratio using lipofectamine (Life Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... in a 1:3 ratio using lipofectamine (Life Technologies) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... PBS containing 1 µM TO-PRO 3 (Thermo Scientific) was applied to each section followed by 3 washes with PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... with TO-PRO-3 (#T3605, ThermoFisher, 1:1000 dilution).
-
bioRxiv - Neuroscience 2021Quote: ... 1-hexanol (99%, ACROS Organics, CAS 111-27-3), 2-oxovaleric acid (>98% ...
-
bioRxiv - Neuroscience 2021Quote: ... passaged 1:2-3 when confluent using Tryple (ThermoFisher). When thawing or passaging the iPSCs ...
-
bioRxiv - Microbiology 2021Quote: ... 3-cholamidopropyl dimethylammonio 1-propanesulfonate (CHAPS; zwitterionic; Thermo Scientific). In addition ...
-
bioRxiv - Developmental Biology 2022Quote: IF blocking buffer: 1/3 Blocker Casein (ThermoFisher 37528), 2/3 HEPM with 0.05% Triton X-100
-
bioRxiv - Molecular Biology 2021Quote: ... containing 1 M sodium chloride (S671-3, Fisher Scientific). The labelling protocol was carried out at pH 7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and benzonase (1:100, Fisher Scientific, 70-664-3) on ice for 30 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-Neuroligin-3 (1:1000, Thermo Fisher Scientific), rabbit anti-COX-2 (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and TO-PRO-3 (1:10,000, Thermo Fisher Scientific). Images were taken using a 20x oil immersion and a 10x dry objective on a Leica TCS SP8 confocal microscope.
-
bioRxiv - Developmental Biology 2023Quote: ... Immunofluorescence blocking solution: 1/3 Blocker Casein (ThermoFisher Scientific), 2/3 HEPM with 0.05% TX-100 ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse-anti-desmocollin-2/3 7G6 (1:250, Invitrogen 32-6200 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cleaved Caspase-3 (Asp175) (1:200, Invitrogen PA5-114687), Tom20 (1:400 ...
-
bioRxiv - Neuroscience 2024Quote: ... 8) anti-GFAP (1/250) (Thermofisher scientific, 3-0300), 9 ...
-
bioRxiv - Microbiology 2024Quote: ... 1% P/S and 3 μg/ml puromycin (Gibco). Human foreskin fibroblasts (HFFs ...
-
bioRxiv - Cancer Biology 2024Quote: ... or TO-PRO-3 Stain (1 µM, ThermoFisher Scientific). Flow cytometry was performed on either an LSRII ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 ng/mL recombinant murine interleukin-3 (IL-3) (Gibco). Cells were grown in a humidified incubator at 37 °C and 6% atmospheric CO2 ...
-
bioRxiv - Immunology 2022Quote: ... 1.9g of ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (ThermoFisher #22980) and 1.2g of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cell Biology 2024Quote: ... human custom-made 3’UTR HEC1 siRNA (oligo #3, Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... and 3-pyridinemethanol (RI = 1.545, 3-PM, A10381, Thermo Fisher Scientific) were used to mix with the water-based SMLM buffer ...
-
bioRxiv - Genomics 2020Quote: ... Genomic PCR products obtained with primers 5’-CGCCATCAACTTCACCTAGC-3’ (forward) and 5’-TCTGGGAAGAAGTTTGGCCT-3’ (reverse) were sequenced using the BigDye® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Massachusetts, USA) on an ABI 3130xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Bioengineering 2021Quote: ... sgRNA LA93527 was generated from a PCR DNA template (overlapping primers LA935 5’-GAAATTAATACGACTCACTATAGGACAGTGCGGTCCG-CAAGGGTTTTAGAGCTAGAAA-3’ and LA137 5’-AAAAGCACCGACTCGGTGCCA-CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’) containing the T7 promoter using the MEGAscript T7 Transcription kit (ThermoFisher Scientific, Walthum, MA USA). The reaction mix was incubated at 37°C for 16 hours and purified using the MEGAclear Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: The brains of P9-11 C57 mice were immersed and fixed for 3 days in cold 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide HCl (EDC, Thermo Fisher Scientific, in 0.1 M PB, pH 7.4) at 4°C ...
-
bioRxiv - Physiology 2020Quote: Caspase-3-like activity was quantified using the EnzChek Caspase-3 Assay kit #1 (Molecular Probes, Eugene, OR, USA). Tissue samples were thawed on ice for 5 min ...
-
bioRxiv - Biophysics 2020Quote: ... hexanoyl)-2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphoethanolamine) (Invitrogen). Cleavage of PED-6 eliminates a self-quenching effect that results in the release of a BODIPY-FL dye ...
-
bioRxiv - Cell Biology 2023Quote: ... for 30 min at room temperature using 10 mM Sodium Acetate [pH 5.0] buffer containing 5μg/ml 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Thermofisher, 22980) as coupling agent ...
-
bioRxiv - Microbiology 2020Quote: ... and probe E_Sarbeco_P1 (5′-FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ-3′) using the TaqPath 1-Step Multiplex Master Mix kit (Applied Biosystems) on a QuantStudio 5 real-time PCR system (Appiled Biosystems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.125 μM Oligo-dT30VN (IDT, 5’AGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Neuroscience 2021Quote: ... a staining solution of 1 mg/mL 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal, Invitrogen), 1× citratesodium phosphate buffer (pH 6.0) ...
-
bioRxiv - Neuroscience 2021Quote: ... slides were washed in 3×5’ PBS and incubated in goat-α-rabbit-555 (1:1000, Life Technologies, A21207) in PBS for 90’ ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were washed in 0.1 M TB (3 ×5 minutes) and then incubated in goat anti-chicken Alexa 488 (1:1000, #A11039, Invitrogen), goat anti-rabbit Alexa 568 (1:500 to 1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... Following preset incubation times (0, 0.5, 1, 3, or 5 h) cells were harvested by trypsinization (500 μl TrypLE, Gibco) for 5 min at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3.125 µM Oligo-dT30VN (IDT, 5′-AAGCAGTGGTATCAACGCAGAGTACT30VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Neuroscience 2024Quote: ... animals were incubated for 5 min in TO-PRO-3 Iodide (642/661) (Invitrogen, cat#T3605, 1:1000 dilution). And last ...
-
bioRxiv - Neuroscience 2024Quote: ... washed 3 x 5 min in PBS at RT and then incubated with Hoechst 33342 (1:5000, Invitrogen, H3570) in PBS for 30 min at RT ...