Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 1 3 Fluorophenyl 5 oxopyrrolidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were washed 3 × 5 min and mounted on slides using Prolong Gold (Invitrogen). Deconvolution wide-field microscopy was performed using the DeltaVision Elite system equipped with an NA 1.42 60x PlanApo objective (Olympus ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Cell Biology 2022Quote: ... CCDC66 was depleted using an siRNA with the sequence 5′-CAGTGTAATCAGTTCACAAtt-3′ (Thermo Scientific). Silencer Select Negative Control No ...
-
bioRxiv - Cell Biology 2024Quote: ... si-PRELID1: 5’-CCCGAAUCCCUAUAGCAAA-3’) were transfected using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778075). Assays were normally carried out 48 h after transfection ...
-
bioRxiv - Genomics 2024Quote: ... and a QuantStudio 3 or QuantStudio 5 Real-Time PCR instrument (Applied Biosystems™). Primers used for qPCR are listed in Suppl ...
-
bioRxiv - Immunology 2024Quote: ... tonsils were rinsed 3 x 5 minutes with 1X PBS (10010023, ThermoFisher Scientific, USA) without agitation ...
-
bioRxiv - Developmental Biology 2022Quote: ... zLL 5’- and 3’- RACE PCRs were performed using the GeneRacer core kit (Invitrogen). Total RNA (2 µg ...
-
bioRxiv - Cell Biology 2023Quote: ... CCDC15 was depleted using an siRNA with sequence 5′-GCAGUACCUGAGACAUAGAtt-3′ (Ambion, Cat. # s36888). For depletion of POC5 ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... after washing 3 times with cold DMEM/F12 (1:1) medium (Gibco), the GBM tissue was cut into small pieces and incubated with dissociation medium (200 μL Collagenase type I (10 mg / mL ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were washed at least 5 times 20 min and transferred to 0.25% PBT with 1:400 TO-PRO-3 (ThermoFisher #T3605) for 2 nights ...
-
bioRxiv - Biophysics 2021Quote: ... slides were rinsed in PBS for 3 x 5 mins and stained with 1 %g/mL 4,6-diamino-2-phenylindole (DAPI - Molecular Probes) for 3 mins in the dark at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... cells were washed 3 x 5 min with PBS before adding secondary antibody (1:200 Alexafluor-488 goat anti-mouse, Invitrogen) and rhodamine phalloidin (1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... Then slides were washed 3×5’ in TBS and incubated in donkey-α-sheep-488 (1:500, Life Technologies, A11015) in TBS for 90’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... Slides were then washed with PBS-T (3 × 5 min) and incubated with fluorophore-conjugated secondary antibodies (1:500 in blocking buffer, Invitrogen). Hoechst 33258 (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... the iMACs were washed 3 x 5 min with PBS and incubated for 1h with 1:1000 goat anti-mouse IgG-AF488 (A11001, Invitrogen). Afterwards the cells were again washed 3 x 5 min with PBS ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation, Oregon, USA) followed by washing with 1x DPBS (nuclei data not shown) ...
-
bioRxiv - Neuroscience 2024Quote: ... The following day the sections were washed 3 times for 5 min each in PBS-T and incubated with the corresponding secondary antibodies (all 1:1000, Invitrogen), for 2 h at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1μl of oligo-dT30VN primer (10 μM 5’-aagcagtggttatcaacgcagagtact30vn-3’) and 1 μl of 10 mM dNTP mix (Thermo Fisher). Illumina libraries were prepared by using a modified smart-seq2 protocol [Picelli 2014] using SuperScript IV RT and tagmentation procedure as previously described [Henning 2018] ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane was washed 3 times with 5% milk TBST and incubated with HRP-conjugated secondary antibodies (1:5000, 32230/32260; Invitrogen). Data were visualized using chemiluminescence detection on ChemiDoc Touch (Bio-Rad Laboratories).
-
bioRxiv - Bioengineering 2023Quote: ... KTB21 human mammary basal epithelial cell line was cultured in epithelial cell growth medium (DMEM [low glucose]: Ham’s F12 [1:3] medium supplemented with 5% FBS [Thermo Fisher Scientific] ...
-
bioRxiv - Developmental Biology 2023Quote: ... Stained samples were washed (3 x 5 minutes) and incubated in DAPI solution (Invitrogen, D3571; diluted 1:1000 in DPBS) for 10 minutes at room temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary cells were cultured in basal medium ((DMEM [low glucose]: Ham’s F12 [1:3] medium supplemented with 5% FBS [Thermo Fisher Scientific] ...
-
bioRxiv - Bioengineering 2024Quote: ... KTB21 human mammary basal epithelial cell line was cultured in epithelial cell growth medium (DMEM [low glucose]: Ham’s F12 [1:3] medium supplemented with 5% FBS [Thermo Fisher Scientific] ...
-
bioRxiv - Biophysics 2021Quote: ... 1 µM of TO-PRO-3 iodide (Thermo Fisher, T3605) was added for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-CENP-A (Clone 3-19, Invitrogen; 1:1000 dilution) and anti-“Bonsai”/NDC80 (68 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-Lamin B2 (mouse, Invitrogen, clone E-3, 1:500), anti-EEA1 (mouse ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 μg mL−1 Cascade Blue (3 kDa, Thermo Fisher) was added to the antibiotic-free expansion media in the top epithelial channel with a flow rate of 30 μL hr−1 ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was diluted 1:3 in nuclease-free water (Ambion) and added to 5 μL SyGreen HiROX mix (PCR Biosystems ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-Galectin-3 (1:200, Invitrogen, 14-5301-82); rabbit anti-Fibronectin (1:500 ...
-
bioRxiv - Bioengineering 2022Quote: ... or Toto-3 iodide (T3604, Invitrogen, MA, USA; 1:500) diluted in PBST ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were counterstained with TO-PRO-3 (1:5,000, Invitrogen) together with secondary antibodies when necessary ...
-
bioRxiv - Microbiology 2020Quote: 1 μL of random primers at 3 μg/μL (Invitrogen) were added to fragmented RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... nuclei were stained with 1 µg/mL TOTO-3 (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Transfection was performed using 1:3 DNA: Lipofectamine 2000 (Invitrogen) ratio ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse anti-INSR (1:50, clone CT-3, Invitrogen, AHR0271).
-
bioRxiv - Immunology 2021Quote: ... either with 1 μM FluoZin-3-AM (Thermo Fisher scientific) at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 3-Isobutyl-1-methylxanthine (IBMX) was from Acros Organics (#228420050). PF-04447943 was purchased from MedChem Express (#HY-15441/CS-0942) ...
-
bioRxiv - Neuroscience 2023Quote: ... Anti-Adenylate Cyclase 3 (IF: 1:500, Invitrogen, PA5-35382); Anti-Ephrin-B1 (IF ...
-
bioRxiv - Microbiology 2022Quote: ... with a 1:3 ratio of siRNA:RNAiMax (Thermo Fisher Scientific). 48 hours post-transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... All lines were maintained in 3:1 DMEM (Gibco, 11960044): F12 media (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: 1” x 3” glass microscope slides (12-550-A3, ThermoFisher) were cleaned with 0.1% Triton X-100 (T9284 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... at 3:1 bead:cell ratio in AIM-V media (Gibco) supplemented with 5% FBS ...
-
bioRxiv - Neuroscience 2023Quote: ... in HBSS and 1 μM YOYO-3 iodide (Thermofisher, Y3606) in the culture media ...
-
bioRxiv - Immunology 2024Quote: ... at a mass ratio of 1:3 in OptiMEM (ThermoFisher). After incubating for 25 minutes ...