Labshake search
Citations for Thermo Fisher :
3401 - 3450 of 10000+ citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The total immunoglobulin E (IgE) level in the serum samples was measured using an IgE mouse ELISA kit (Thermo Fisher Scientific, Waltham, Mass, USA) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... 10 μgs of protein were loaded into manually coated IL-22 96-well High Affinity plates and IL-22 levels were determined by IL-22 ELISA kit (ThermoFisher-Scientific #88-7422-22) following manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... IL-33 and IL-25 concentration was determined via Enzyme-Linked Immunosorbant Assay (ELISA) kit according to manufacturer’s protocol (IL-33: R&D Systems, DY362605; IL-25: Invitrogen, 88-7002-22).
-
bioRxiv - Immunology 2024Quote: ... Supernatant was collected 24 hours later for analysis of IL-12p40 and IL-6 production by ELISA (Thermo Fisher Scientific Ready-SET-Go! Kit) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... and nuclear PPARα in V1 were measured using ELISA kits according to manufacturer’s instructions (total AMPK: ab181422, Abcam, UK; phosphorylated AMPK: KHO0651, ThermoFisher, UK; PPARα: ab133107, Abcam, UK). For tissue collection ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was synthesized from 1 μg of total RNA using an Invitrogen two-step kit with SuperScript™ III (#18080051, Invitrogen, Carlsbad, CA, USA) as the reverse transcriptase (RT ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 1 μg of the total RNA of each sample was reverse-transcribed into cDNA using SuperScript III cDNA Synthesis Kit (Thermo Scientific, Rockford, IL, USA). Real-time PCRs were performed using the TaqMan™ Universal Master Mix (Thermo Fisher scientific ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5’ TCTCGCTGGGGACTCTGGTTGAAAT 3’) primers (Eurofins, Louisville, KY) and SuperScript™ III One-Step RT-PCR kit with Platinum™ Taq DNA Polymerase (Invitrogen, Carlsbad, CA) using the following thermocycler conditions ...
-
bioRxiv - Microbiology 2020Quote: ... a 663-bp RT-PCR product was amplified from extracted RNA using a SuperScript™ III One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA). A 20-μl reaction was assembled in PCR 8-tube strips through the addition of 10 μl 2× reaction mix ...
-
bioRxiv - Microbiology 2020Quote: ... Viral RNA was reverse-transcribed and amplified using the SuperScript III High Fidelity One-Step RT-PCR kit (Invitrogen, Life Technologies, Carlsbad, CA, USA). The reverse transcription-PCR conditions were as follows ...
-
bioRxiv - Microbiology 2020Quote: ... Viral RNA was reverse-transcribed and amplified using the SuperScript III High Fidelity One-Step RT-PCR kit (Invitrogen, Life Technologies, Carlsbad, CA, USA). The reverse transcription-PCR conditions were as follows ...
-
bioRxiv - Microbiology 2021Quote: ... The quantitative real-time PCR assay was performed with SuperScript III Platinum SYBR Green One-Step qRT-PCR kit (Thermo Scientific, Wilmington, DE, USA). For each sample ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was synthesized from 1 µg total RNA template with oligo-dT primers using a SuperScript® III First-Strand Synthesis kit (ThermoFisher Scientific, 18080-051) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... The Fluidigm Access Array system (San Francisco, CA, USA) and SuperScript™ III One-Step RT-PCR kit with Platinum™ Taq High Fidelity polymerase (Thermo Fisher Scientific) were used for full genome amplification ...
-
bioRxiv - Microbiology 2020Quote: 400-500 bp of RT-PCR product were synthesized and amplified from extracted RNA using a SuperScript™ III One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA). 20μl reactions were assembled in PCR 8-tube strips through the addition of 10μl 2X reaction mix ...
-
bioRxiv - Plant Biology 2023Quote: ... was used to extract total RNA from plant tissues and around 1.5 µg of DNAseA treated RNA was taken for cDNA synthesis using oligo-dT and random hexamers mix as primers (Invitrogen - SuperScript III RT kit). The cDNA template was used for qPCRs using SYBR green (Solis Biodyne – 5x HOT Firepol Evagreen qPCR master mix ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA was extracted and RNA samples were prepared using the SuperScript™ III Platinum™ SYBR™ Green One-Step qRT-PCR Kit (Invitrogen 11736059) as previously described by our laboratory (Darnieder et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... An equal amount of RNA from each sample was used to generate complementary DNA (cDNA) with the SuperScript™ III First-Strand Synthesis SuperMix kit (Thermo Fisher Scientific, 18080400). The resulting cDNA was diluted 1:8 in nuclease-free water and analyzed by real-time PCR using the following TaqMan assays ...
-
bioRxiv - Plant Biology 2023Quote: ... First strand cDNA was synthesised using SuperScript® III First-Strand Synthesis System for RT-PCR kit (18080-051, Life technologies, Carlsbad, California, USA). 1 μL each of 50 μM oligo(dT)20 and 50 ng/μL random hexamers were included in the first-stand cDNA synthesis ...
-
bioRxiv - Cancer Biology 2022Quote: ... Synthesis of the cDNA first strand was performed from 1 μg of total RNA in 20 μl volume using oligo(dT)18 primer and SuperScriptTM III Reverse Transcriptase Kit (Thermo Fisher Scientific, Carlsbad, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: Antibodies (Human Siglec-1, PE conjugated Anti-Human CD14, FITC conjugated Anti-Human CD16) were obtained from Thermo Fisher Inc ...
-
bioRxiv - Immunology 2020Quote: ... Supernatants were harvested and cytokine concentrations measured by ELISA (Thermo Fisher) and cells were stained and analysed using flow cytometry as described below.
-
bioRxiv - Immunology 2020Quote: ... Supernatants were harvested and cytokine concentrations measured by ELISA (Thermo Fisher) and cells were stained and analysed using flow cytometry as described below.
-
bioRxiv - Immunology 2022Quote: ... 1-Step™ Ultra TMB-ELISA Substrate Solution (ThermoFisher Scientific: 34029) was added for colorimetric detection ...
-
bioRxiv - Immunology 2022Quote: ELISAs were performed on 96-well half-area microplates (ThermoFisher Scientific) as described previously 15 ...
-
bioRxiv - Cell Biology 2020Quote: ... 100 μL 1-Step Ultra TMB – ELISA Substrate (Thermo Scientific 34028) was added to each well and incubated at room temperature for 30 mins ...
-
bioRxiv - Immunology 2021Quote: ... Incubation was performed in a 96-well ELISA plate (Nunc Maxisorp) pre-treated with PBS containing10% FCS for 1 h at 4°C to avoid direct binding of serum IgG to the plate ...
-
bioRxiv - Immunology 2021Quote: High binding ELISA plates (Thermo Scientific, catalog no 44-2404-21) were coated at 0.5µg/mL with goat anti-mouse IgG2b (Southern Biotech ...
-
bioRxiv - Biochemistry 2020Quote: ... The ELISA was developed using 3,5,3′,5′-tetramethylbenzidine (TMB, Thermo Scientific) solution and the reaction was stopped after 10 min incubation using 0.16M Sulfuric acid ...
-
bioRxiv - Bioengineering 2021Quote: ... ELISA was performed according to manufacturer’s protocols for Ang-1 (ThermoFisher) and Ang-2 (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... ELISAs were developed by addition of TMB solution (Thermo Fisher Scientific) and quenched using 10% phosphoric acid ...
-
bioRxiv - Bioengineering 2021Quote: ... 100 μL of Slow TMB-ELISA substrate solution (#34024, Thermo Fisher) was added per well ...
-
bioRxiv - Immunology 2020Quote: ... ELISA assays were done with material and reagents from Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: Nunc MaxiSorp round-bottom 96-well ELISA microtiter plates (Thermo Scientific) were coated overnight at 4°C with 10 μg/ml HSV-1 inactivated Vero cell extract (Advanced Biotechnologies) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ELISAs were performed with 96-well MaxiSorp plates (Thermo Scientific, 442404).
-
bioRxiv - Immunology 2020Quote: ... Incubation was performed in a 96-well ELISA plate (Nunc maxisorp) pre-treated with PBS/10% FCS (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... or S15 proteins were quantified by ELISA assay (Thermo Fisher Scientific) and stored at −80□.
-
bioRxiv - Bioengineering 2021Quote: 96-well ELISA plates (Nunc MaxiSorp flat-bottom plates, Thermo Fisher) were coated with 10 nM RBD ...
-
bioRxiv - Microbiology 2020Quote: ... the wells of 384-well ELISA plates (NUNC Maxisort cat# 464718) were coated with 15 µl of 4 µg/ml neutravidin (ThermoFisher cat # 31000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... One-Step™ Turbo TMB-ELISA Substrate Solution (Thermo Fisher Scientific) was added to the wells for color development ...
-
bioRxiv - Immunology 2020Quote: ... Nunc high-binding ELISA plates (Thermo Fisher Scientific; Waltham, MA, USA) were coated with 2 μg/ml of recombinant SARS-CoV-2 proteins (S1 and RBD-His proteins were produced in the lab and S1 +S2 ECD spike protein was purchased from Sino Biologicals ...
-
bioRxiv - Immunology 2020Quote: ... using 1-Step™ Slow TMB-ELISA (Thermo Scientific, Rockford, IL) and 2N HCl according to manufacturer’s directions ...
-
bioRxiv - Immunology 2020Quote: ... mouse IFNβ (PBL Biomedical Laboratories) and mouse CXCL10 ELISA (ThermoFisher; BMS6018MST) were obtained from commercial sources.
-
bioRxiv - Immunology 2021Quote: ... IFN-α in the culture supernatant was measured using ELISA (Invitrogen).
-
bioRxiv - Immunology 2022Quote: ... plates were developed using SuperSignalTM ELISA Femto Maximal Signal Substrate (ThermoFisher) and absorbance was measured at 425 nm ...
-
bioRxiv - Immunology 2023Quote: ... ELISAs were developed by addition of TMB solution (Thermo Fisher Scientific) and quenched using 10% phosphoric acid ...
-
bioRxiv - Bioengineering 2023Quote: ... ELISA plates (MaxiSorp 96 well plates, Thermo Fisher #12-565-135) were coated overnight at room temperature with influenza A/Puerto Rico/8/34 virus particles (400 HAU/ml ...
-
bioRxiv - Immunology 2023Quote: ... ELISAs were developed by addition of TMB solution (Thermo Fisher Scientific) and quenched using 10% phosphoric acid ...
-
bioRxiv - Bioengineering 2024Quote: ... Cell supernatants were collected and assayed using a TNFα ELISA (Invitrogen).
-
bioRxiv - Immunology 2023Quote: Nunc MaxiSorp 96 well ELISA plates (Thermo Fisher Scientific, Waltham, MA) were coated at 4°C overnight with filovirus GPs ...