Labshake search
Citations for Thermo Fisher :
3601 - 3650 of 10000+ citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was reverse transcribed from mRNA with Superscript III (Invitrogen, ThermoFisher) and quantitative RT-PCR reactions were conducted with 20 ng of template using custom primers (Table 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Reverse transcription was performed using SuperScript III reverse transcriptase (Life Technologies). Isolated RNA was used to perform ddPCR to determine Fshr mRNA levels using FSHR Probe (Life Technologies ...
-
bioRxiv - Genetics 2024Quote: oligo dT and 2 μl of SuperScript III (Thermo Fisher Scientific) in a 20 μl reaction ...
-
bioRxiv - Genetics 2024Quote: ... Random primed cDNA was prepared with SuperScript III reverse transcriptase (Invitrogen) as per standard protocols and all samples had an equivalent RT- reaction ...
-
bioRxiv - Immunology 2024Quote: ... RNA was reverse transcribed into cDNA using Superscript III RT (Invitrogen). The expression of various genes was quantified using Fast SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... and cDNA was created using SuperScript III reverse transcriptase (#18080044, Invitrogen). Taqman probes for hmox1 (Hs01110250_m1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was generated from total RNA using Superscript III (Thermo Fisher) followed by PCR amplification using Ex-Taq polymerase (Takara ...
-
bioRxiv - Biophysics 2023Quote: Spodoptera frugiperda Sf9 cells in SF900 III SFM medium (Thermo Scientific) were transfected with purified bacmid from DH10EMbacY cells (Intact Genomics ...
-
bioRxiv - Molecular Biology 2023Quote: ... reverse transcribed with Superscript III Reverse Transcriptase enzyme (18080-044; Invitrogen). Sequencing libraries were generated using Phusion DNA polymerase with TruSeq small-RNA adaptors and sequenced at NOVOGene USA using NextSeq500 (Illumina).
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription with Superscript III First-Strand synthesis supermix (ThermoFisher Scientific) and 5 µM RT Primer (RTP ...
-
bioRxiv - Physiology 2023Quote: ... cDNA was synthesized using SuperScript III (Thermo Fisher, Waltham, Massachusetts, USA). qRT-PCR was carried out with the Agilent MX3000 system (Agilent ...
-
bioRxiv - Physiology 2023Quote: ... and cDNA was retro-transcribed using SuperScript III (Invitrogen #18080-044). Semi quantitative qPCR was performed on biological triplicates using SYBR Green I Master mix on a LightCycler® 480 (Roche) ...
-
bioRxiv - Pathology 2023Quote: ... and reverse transcribed using the SuperScript™ III Reverse Transcriptase (Invitrogen) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2024Quote: ... SuperScript™ III One-Step RT-PCR (ThermoFisher Scientific, Waltham, MA) was used according to the manufacturer’s instruction to amplify Mu Mx1 RNA using Mu Mx1 specific primers ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using SuperScript III Reverse Transcriptase (Invitrogen). One reaction was done in total volume of 15 μl including ...
-
bioRxiv - Physiology 2024Quote: ... Reverse transcription was performed using SuperScript III (Invitrogen, Waltham, Massachusetts, USA). PCR and quantification were performed using a StepOnePlus Real-Time PCR System (Applied BioSystems ...
-
bioRxiv - Microbiology 2023Quote: ... and diluted RNase III (stock I U/ul, Ambion Cat# AM2290) to 100 U/ml with buffer and ddH2O (with a volume ratio of 1:1:8) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... cDNA was synthesised using the SuperScript® III Reverse Transcriptase (ThermoFisher) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was then synthesized using the Superscript III reverse transcriptase (ThermoFisher) in conjunction with random hexamere and oligo(dT ...
-
bioRxiv - Microbiology 2023Quote: ... extracted RNA was reverse transcribed by SuperScript III reverse transcriptase (Invitrogen) and 32P-labelled NA-specific primers along with a primer targeting endogenous 5S rRNA as an internal control ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cDNA was prepared using SuperScript III (ThermoFisher, Waltham, MA, USA) and random primers following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was made by SuperScript III first-strand synthesis supermix (Invitrogen). Then real-time PCR was performed by the Syber green method (51) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and cDNA was synthesized using SuperScript III (Invitrogen, Carlsbad, CA, USA) with random hexamers.
-
bioRxiv - Cell Biology 2023Quote: ... and retrotranscribed to cDNA with SuperScript III RNase Transcriptase (Invitrogen, Spain) with Random hexamer (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... which was then converted to cDNA using Superscript III (Invitrogen 18080051). VHH genes were amplified using gene specific primers for long- and shot-hinge heavy-chain-only antibodies (Maass et al. ...
-
bioRxiv - Microbiology 2023Quote: ... using SuperScript III First Strand Synthesis SuperMix (Invitrogen, Cat. No. 18080400). We normalized amount of input RNA across all samples in the experiment ...
-
bioRxiv - Genomics 2022Quote: ... and counted via a Countess III cell counter (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mM DTT) and 0.5 μL reverse transcriptase Superscript III (Invitrogen) and mixing quickly with a pipette ...
-
bioRxiv - Molecular Biology 2022Quote: ... First strand cDNA was synthesized using reverse transcriptase Superscript III (Invitrogen) and oligo dT primer with home-made RT buffer (20 mM Tris (pH 8.3) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 mM DTT and 150 U Superscript III (Thermo Fisher Scientific) were added to a final volume of 14.25 µL ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was prepared with SuperScript III first-strand synthesis system (Invitrogen). qRT–PCR of Foxo1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Reverse transcription was performed using SuperScript III reverse transcriptase (ThermoFisher, 18080093) and 2 µg of RNA ...
-
bioRxiv - Genomics 2022Quote: Reverse transcription was performed with SuperScript III RT enzyme (Life Technologies) following manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was synthesised with super-script-III (Life Technologies, Carlsbad, CA). Gene expression levels were analysed in QuantStudio™ 5 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA samples were reverse transcribed with Superscript III Reverse Transcriptase (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... and RNA was converted into cDNA (SuperScript III Reverse Transcriptase, Invitrogen) using random hexamers (Bioline Reagents Ltd ...
-
bioRxiv - Immunology 2023Quote: ... and a Superscript III Platinum One-Step qRT-PCR System (ThermoFisher). Primers and reporter probe bind to the LTR and their sequences are GCTAGACTCTCACCAGCACTTG (forward) ...
-
bioRxiv - Neuroscience 2023Quote: ... Reverse transcription was then performed using Superscript III (Invitrogen, Scoresby, Australia), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... single-cycle cDNA synthesis using random primers and Superscript III (Invitrogen), library tagmentation and 16-cycle PCR amplification using Nextera XT (Illumina) ...
-
bioRxiv - Cell Biology 2024Quote: ... The first-strand cDNA was synthesized by SuperScript III (ThermoFisher Scientific) or ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO Co. ...
-
bioRxiv - Genomics 2024Quote: ... cDNA was synthesized using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA) according to manufacturer’s instructions at a concentration of 3000 ng/ml and used as a template for the RT-qPCR standard curve ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was synthesized using Superscript III reverse transcriptase (ThermoFisher Scientific, #18080085), and amplified using KAPA SYBR FAST qPCR Kit and designed primers targeting specific genes ...
-
bioRxiv - Genomics 2024Quote: ... RNA was reverse transcribed using Superscript III system (Invitrogen, 18080-051). Residual dNTP was removed using ethanol precipitation ...
-
bioRxiv - Cancer Biology 2024Quote: ... and reverse transcription was performed using SuperScript III (Invitrogen cat. 18080093) with gene-specific primers (GSP) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was prepared using oligodT and SuperScript III Reverse Transcriptase (Invitrogen). The cDNA was then used for qPCR with SYBR Green and Taq polymerase on a CFX OPUS 384 Real-Time PCR System ...
-
bioRxiv - Microbiology 2024Quote: ... Complementary DNA (cDNA) was generated using SuperScript III Reverse Transcriptase (Invitrogen) and a random primer ...
-
bioRxiv - Molecular Biology 2024Quote: cDNA was prepared using Superscript III First-Strand Synthesis System (Invitrogen) or Lunascript (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the DNase-treated RNA was reverse transcribed using Superscript III (Invitrogen) and random hexamers or oligo d(T)20 where indicated ...
-
bioRxiv - Molecular Biology 2024Quote: ... Complementary DNA (cDNA) was synthesized using SuperScript III reverse transcriptase (Invitrogen) using equal amounts of RNA ...
-
bioRxiv - Immunology 2024Quote: ... reverse transcriptions were carried out with Superscript III (Thermo Fisher Scientific) and random hexamer primers (Promega ...