Labshake search
Citations for Thermo Fisher :
3201 - 3250 of 10000+ citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Evaluation of NF-kBp65 and CREB activation was performed in infected or uninfected monocytes using NF-kB p65 (Total/Phospho) InstantOne™ and CREB (Total/Phospho) Multispecies InstantOne™ ELISA Kits (Thermo Fisher), according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: Total IgG and IgM from Snca+/+ and Snca-/- were measured by commercially available ELISA kits (Invitrogen, #88-50400-22 and #88-50470-22) according to manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were lysed and protein normalised following content assessment by the Bradford reagent (Walker and Kruger, 2003) for use in an InstantOne™ total/phosphor multispecies p38 ELISA kit (ThermoFisher Scientific, UK) according to the manufacturer’s instructions ...
-
Role of autophagy in sepsis-induced skeletal muscle dysfunction, whole-body metabolism, and survivalbioRxiv - Cell Biology 2021Quote: The concentration of IL-1β in GAS muscle extracts at 2-day post-surgery was measured using Mouse IL-1 β ELISA Kit (Invitrogen #88-7013), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ELISAs for mouse studies were performed for the quantitative measurement of total mouse IgG production in plasma samples using IgG (Total) Mouse Uncoated ELISA Kit (Invitrogen, #88-50400-22) for BALC/c cohorts and IgG (Total ...
-
bioRxiv - Biochemistry 2023Quote: α-synuclein was quantified in the striatum region of mouse brain utilizing the Enzyme-linked Immunosorbent Assay (ELISA) Kit from Invitrogen (Cat No. KHB0061) following the manufacturer‘s instructions.
-
bioRxiv - Bioengineering 2024Quote: To measure the mOx40L protein abundance in EVs the Mouse TNFSF4 solid-phase sandwich ELISA (enzyme-linked immunosorbent assay) kit (Invitrogen, Thermo Fisher Scientific) was used according to the manufacturer’s instructions ...
-
The intersection of endocrine signaling and neuroimmune communication regulates neonatal nociceptionbioRxiv - Neuroscience 2024Quote: ... The levels of MCP1 in the muscle lysate were measured by commercial MCP-1 Mouse ELISA Kit (Catalog No. BMS6005, Invitrogen Thermo Fischer Scientific). Briefly ...
-
bioRxiv - Immunology 2024Quote: ... and IL-17A were measured from memory Th cell supernatants using commercially available sandwich ELISA kits according to manufacturer protocols (ThermoFisher Scientific, Burlington, Canada). Modifications included 75µL of coating and capture antibody per well ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μg of total RNA was treated with DNase I (#M0303) and reverse transcribed using SuperScript III First-Strand cDNA synthesis kit (Thermo Fisher Scientific, #18080051). The resulting cDNAs were quantified using the real time PCR (StepOne Plus ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA of 100 ng/μL concentration was synthesized using the SuperScript III First Strand Synthesis SuperMix Kit (cat. 18080-051, ThermoFisher Scientific, Massachusetts, USA). qPCR was performed with Apex Probe Master Mix (cat ...
-
bioRxiv - Immunology 2021Quote: ... The viral genome was evaluated by quantitative real-time PCR using the Superscript ® III Platinum ONE-STEP RT-PCR system kit with the Platinum™ Taq DNA polymerase system (Invitrogen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR was performed in 50μl reactions using the SuperScript™ III Platinum™ SYBR™ Green One-Step RT-qPCR kit (Invitrogen™) with 200 ng of total RNA as template ...
-
bioRxiv - Plant Biology 2022Quote: ... First-strand complementary DNA was synthesized from 2 μg total RNA using oligo(dT)18 primers in a 25 μL reaction volume with the SuperScript III Reverse Transcriptase Kit (Invitrogen, Carlsbad, CA, USA). The reverse-transcribed RNA (cDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... qRT-PCR was performed on a Stepone software v2.3 system instrument with SuperScript® III Platinum® One-Step qRT-PCR Kit w/ROX (Invitrogen, CA, USA). The detailed protocol is shown in Table S1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA synthesis was performed from 800 ng of RNA using the SuperScript® III First-Strand kit (Thermo Fisher Scientific, Invitrogen, Ref: 12574018). RT-qPCR was performed with an CFX Connect Real-Time system (Bio-Rad Laboratories Inc. ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA synthesis was performed from 800 ng of RNA using the SuperScript® III First-Strand kit (Thermo Fisher Scientific, Invitrogen, Ref: 12574018). RT-qPCR was performed with an CFX Connect Real-Time system (Bio-Rad Laboratories Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was reverse transcribed using the oligo dT reverse transcription kit SuperScript® III First-Strand Synthesis System (Life Technologies, cat. no. 18080051). The bovine Creb5 open reading frame (508aa ...
-
bioRxiv - Immunology 2021Quote: ... Beads were re-emulsified in an overlap extension RT-PCR mixture using the SuperScript III RT-PCR Kit (Thermo Fisher Scientific, Waltham, MA) with the incorporation of custom designed TCR cloning primers (Supplementary Table 2)53 ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed with 5uL of RNA extract and 15uL of supermix (SuperScript™ III Platinum™ One-Step RT-qPCR Kit, Invitrogen™), using primers for E_Sarbeco_F 5‘ACAGGTACGTTAATAGTTAATAGCGT 3’ and Rev E_Sarbeco_R 5’ ATATTGCAGCAGTACGCACACA 3’ (7).
-
bioRxiv - Immunology 2020Quote: ... and either used for sequencing or converted into cDNA using a SuperScript III First-Strand cDNA kit according to manufacturer’s protocol (Thermo Fisher, Waltham, MA, USA). Quantitative RT-PCRs were performed using SYBR GreenER qPCR SuperMix (mo Fisher ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was reverse transcribed from total patient and control RNA samples using random hexamers primers from the SuperScript™ III First-Strand Synthesis System for RT-PCR kit (Invitrogen, Carlsbad, CA) according to manufacturer’s guidelines ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was isolated from wild type N2 animals using trizol and phenol-chloroform extraction followed by RT-PCR using Superscript III One Step RT-PCR system with Platinum Taq DNA polymerase kit (ThermoFisher Scientific cat #: 12574026) to prepare the cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... The CLIP-RT-qPCRs were performed using the SuperScript™lJ III Platinum™lJ SYBR™lJ Green One-Step kit (#11736-051, Invitrogen) on the CFX96 thermocycler (Bio-Rad) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 600 ng of quality-checked RNA of all samples was used to synthesize cDNA with the Superscript III RT kit (Thermo Fisher, Waltham, USA). To generate a standard-curve for determining absolute RNA copy numbers of each tested gene ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative PCR (qPCR) reactions were prepared using an Invitrogen Superscript III Platinum SYBR Green One-Step qRT-PCR kit (Fisher Scientific, Cat. #11736051) according to the manufacturer protocol and analyzed on a BioRad CFX96 real-time qPCR system.
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA (2 μg) was reverse transcribed in a final volume of 10 μL using SuperScript™ III Reverse Transcriptase kit (ThermoFisher Scientific®,) with oligo-p(dt)15 (Roche® ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Complementary DNAs (cDNAs) were generated from 300 ng of total RNA using the SuperScriptTM III first strand synthesis SuperMix kit (Thermo Fisher Scientific, 18080400) and then diluted 20 times with DNase-free water ...
-
bioRxiv - Genetics 2022Quote: ... Total RNA was extracted from N2 animals with Trizol and phenol-chloroform prior to cDNA synthesis using RT-PCR with the Superscript III One Step RT-PCR system with Platinum Taq DNA polymerase kit (ThermoFisher Scientific cat #: 12574026). The resultant PCR product was used as a template for in vitro transcription (IVT ...
-
bioRxiv - Genetics 2022Quote: ... The material was then subjected to a complementary DNA (cDNA) synthesis using the Superscript III First Strand Synthesis Supermix Kit (Thermo Fisher Scientific, USA). The second strand cDNA synthesis was performed using Klenow fragment 3’-5’ exo (New England Biolabs Inc ...
-
bioRxiv - Microbiology 2024Quote: ... First strand cDNA synthesis was carried out from 1 μL total RNA at 1 μg/μL with random hexamer primers and Superscript III RT kit (Invitrogen Inc., Carlsbad, CA) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was extracted from tomato (Rio Grande) using the Qiagen RNeasy Plant Mini Kit (Cat. 74904) and used to generate cDNA (Invitrogen SuperScript III, 12574018). The cytoplasmic domains of the SERKs (SERK3A-CD and SERK3B-CD ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cDNA plasmids in pcDNA™4/TO Mammalian Expression Vector were transiently transfected into Expi293F™ cells stably expressing human FHF2b and human SCN1B subunit (polyclonal) background using ExpiFectamine™ 293 Transfection Kits (Gibco,Thermo Fisher Scientific CAT #: A14524). Induction was achieved using Tetracycline (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mg/mL Collagenase Type I (Gibco 17100-017), and 0.1 mg/mL of DNase I (Roche 10104159001) ...
-
bioRxiv - Biochemistry 2020Quote: ... coli (type B cells, ATCC 11303 strain, 14380, Affymetrix) DNA was fragmented by a limited SauIIIA or AluI digest ...
-
bioRxiv - Molecular Biology 2021Quote: ... coated with rat tail collagen type I (Fisher Scientific). Single cells were seeded in AO growth medium ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.2% collagenase type II (Gibco, Palo Alto, CA, USA), 0.1 mg/mL DNase I (from bovine pancreas ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by incubation with 0.2% collagenase type II (Gibco) in PBS for 20 min ...
-
bioRxiv - Cell Biology 2020Quote: ... and DNAse Type I at 800 units/mL (ThermoFisher) made in sterile PBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.1 mg/mL soybean trypsin inhibitor type I (Invitrogen), 5 mL/L insulin-transferrin-selenium (ITS Premix ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 1 mg/ml type IV collagenase (17104019, GIBCO) for 30min at 37 ℃ with intermittent shaking ...
-
bioRxiv - Biophysics 2021Quote: ... and separated by collagenase treatment (Gibco, Collagenase type II). Isolated oocytes were kept at 18°C ...
-
bioRxiv - Cell Biology 2020Quote: ... spheroids were treated with Type IV collagenase (Gibco 17104019) for 24 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... Wild-type murine C2C12 were maintained in DMEM (Invitrogen) supplemented with 20% fetal bovine serum gold (PAA ...
-
bioRxiv - Bioengineering 2023Quote: ... 50 U/mL collagenase type II (Thermo Fisher 17101015), and 100 U/mL hyaluronidase (Sigma Aldrich H3506 ...
-
bioRxiv - Bioengineering 2023Quote: ... Hes were passaged using Collagenase Type IV (Gibco, U.S.A.). At 90-95% confluency ...
-
bioRxiv - Immunology 2023Quote: ... 150 U/ml collagenase type I (Gibco, 17100-017), and 50 U/ml DNase I (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... which contains 2 mg/mL collagenase type I (Gibco) dissolved in OR2 buffer (82.5 mM NaCl ...
-
bioRxiv - Microbiology 2023Quote: Wells of microtiter plates (type II, F96 Maxisorp, Nunc) were coated overnight at 4°C with 100 ng of recombinant SARS-Cov-2 S-2P ...
-
bioRxiv - Pathology 2023Quote: ... 10mg/mL Collagenase Type 4 (Gibco, 17-105-019), 2 mg/mL Dispase II (Roche Applied Biosciences ...