Labshake search
Citations for Thermo Fisher :
3401 - 3450 of 10000+ citations for Heme oxygenase 1 HO 1 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 1% (v/v) penicillin/streptomycin and 1% non-essential amino acids (NEAA, Gibco). All cell cultures were kept in a 37ºC incubator with 5% CO2 and passaged every 2-3 days ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-Tra-1-60 (Thermo Fisher Scientific, 41-1000, IF 1:300), mouse anti-Tra-1-81 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-Tra-1-81 (Thermo Fisher Scientific, 41-1100, IF 1:300), rabbit anti-Oct4 (Abcam ...
-
bioRxiv - Genetics 2023Quote: ... and 1% v/v MRI in 1× T4 ligase buffer (Thermo Scientific, EL0014). To perform the T4 ligation step ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... supplemented with 1/2 x N2 and 1 x B27 (Thermo Fisher Scientific), 1% Penicillin/Streptomycin (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... DAPI (1:1000) and cell mask deep red (1:5000, Thermo Fisher, C10046) were diluted in PBS/0.05% Triton and incubated for 10 min ...
-
bioRxiv - Bioengineering 2023Quote: ... 1:200 ZO-1 conjugated antibody (cat no. MA3-39100-A647, Thermo Fisher) and 1:10,000 Hoechst (cat no ...
-
bioRxiv - Neuroscience 2023Quote: Organoids were incubated in 1 mM of X-Rhod-1 AM dye (Invitrogen) diluted in a modified HEPES buffer (130mM NaCl ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 1% non-essential amino acids and 1% sodium pyruvate (Gibco, Invitrogen, Merelbeke, Belgium). The cells were kept in a humidified 37°C incubator with a 5% CO2 environment ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 1% non-essential amino acids and 1% sodium pyruvate (Gibco, Invitrogen, Merelbeke, Belgium). The cells were kept in a humidified 37°C incubator with a 5% CO2 environment ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (1 M) (Invitrogen, cat.#15630080), CellMask membrane dye (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... using a 1:1 dilution of Trypan Blue Stain (Thermo Fisher Scientific, T10282) on Countess Cell Counting Chamber Slides (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and goat anti-mouse Alexa Fluor 555 (1:200, 1:1000, Invitrogen Corporation). Then slides were PBS and immersed into Vectashield with 4′,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Neuroscience 2023Quote: ... and then stained with Hoechst 33342 (Invitrogen, diluted 1:5000 in 1 × PBS) for 1 h on a rotator at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Kir4.1 antibody (Thermo Scientific, rabbit, 1:1000, Cat No. 12503-1-AP), Kir3.1/KCNJ3 antibody (Santacruz ...
-
bioRxiv - Bioengineering 2023Quote: ... Inner ear tissue was immersed in 1 μM FM 1-43FX (ThermoFisher, F35355) dissolved in DPBS (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... and penicillin-streptomycin (10,000 U ml−1, 1:100; Thermo Fisher Scientific, 15140122). The neural medium was supplemented with 20 ng ml−1 epidermal growth factor (EGF ...
-
bioRxiv - Neuroscience 2023Quote: ... and maintained in N2B27 media (1:1 of DMEM F12 Glutamax [Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... after incubation with secondary antibodies (1:500-1:600, Alexa Fluor, Thermo Fisher Scientific or Jackson ImmunoResearch Labs) ...
-
bioRxiv - Pathology 2024Quote: ... si-TGF-beta activated kinase 1 binding protein 1 (TAB1, Thermo Fisher Scientific) was transfected into hDPCs using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... and 1:500 Alexa Fluor 568 donkey anti-mouse (Invitrogen, A10037, 1:500) in PBS for 1h at RT ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD4 antibody (both 1:1500) and DAPI (1 µg/mL, Thermofisher Scientific) or propidium iodide (0.2 µg/mL ...
-
bioRxiv - Physiology 2024Quote: ... using 150 µL·well-1 1× RIPA lysis buffer (#J62524-AE, Thermo Fisher Scientific) containing 10 µL·mL-1 phosphatase inhibitor and 1 µL·mL-1 protease inhibitor cocktail (#78440 ...
-
bioRxiv - Neuroscience 2024Quote: ... iPSCs underwent neural induction in N2B27 media [1:1 DMEM-F12 Glutamax (Gibco): Neurobasal (Gibco ...
-
Tumor microenvironment acidosis favors pancreatic cancer stem cell properties and in vivo metastasisbioRxiv - Cancer Biology 2024Quote: ... lysates were mixed with 1:1 NuPAGE LDS 4x Sample Buffer (Invitrogen, #NP0007) and 0.5 M dithiothreitol (Sigma #646563 ...
-
bioRxiv - Molecular Biology 2024Quote: ... MSCs were cultured in 1:1 DMEM/F-12 medium (Gibco; 11320-074) supplemented with 10% fetal bovine serum (Euroclone ...
-
bioRxiv - Microbiology 2024Quote: ... 1:500) diluted in 1% BSA in PBS with 160U/mL RNaseOUT (Invitrogen) for 45 min at room temp (RT) ...
-
bioRxiv - Microbiology 2024Quote: ... 1:500) diluted in 1% BSA in PBS with 160U/mL RNaseOUT (Invitrogen) overnight at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... REP medium consisted of a 1:1 mix of RPMI (Gibco, Cat. 7001612) and X-Vivo (Lonza ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...