Labshake search
Citations for Thermo Fisher :
3351 - 3400 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The cDNA was used as input in quantitative RT-PCR reactions using PowerUp™ SYBR™ Green Master Mix (A25742, Thermo Fisher). All primers were obtained from integrated DNA Technologies and sequences are 5’-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... The RNA pellet was resuspended and the supernatant containing RNA from each individual’s inner ears was prepared for RT-PCR using the SuperScript Strand Synthesis System kit (Invitrogen, cat. no. 11904018). The resulting cDNA was stored at −20°C for one week or less before real-time qPCR ...
-
bioRxiv - Microbiology 2022Quote: ... and then the viral copy number in each sample was estimated by qRT-PCR using TaqPath™ 1-Step RT-qPCR Master Mix (Thermo Fisher) and 2019-nCov CDC EUA Kit (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2022Quote: Complementary DNA (cDNA) was obtained from 2-5µg total RNA using the SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA, EUA) according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... was reverse transcribed according to the protocol supplied with SuperScriptIII First-Strand Synthesis System for RT-PCR (Catalog# 18080-051, Invitrogen Life Technologies). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Neuroscience 2024Quote: ... and TBR1 Hs00232429_m1) were used and RT-qPCR was run in triplicate samples on a QuantStudio™ 1 Real-Time PCR System (ThermoFisher Scientific) with GAPDH as the housekeeping gene (HS02786624_g1)
-
bioRxiv - Genomics 2024Quote: ... We then compared the performance of the different kits in terms of detection and quantification rates using standard RT-PCR (Applied Biosystems 7500 Fast Instrument, Thermo Fisher) and portable RT-PCR (Magnetic Induction Cycler quantitative PCR (Mic qPCR) ...
-
bioRxiv - Microbiology 2024Quote: ... RT-PCR was performed on extracted maPgV RNA according to recommendations from PrimalScheme using the SuperScript IV One-Step RT-PCR System (Invitrogen, Waltham, MA). Following cleanup with Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... Conventional two step reverse transcriptase polymerase chain reaction (RT-PCR) was employed using the Invitrogen SuperScript IV first-strand synthesis system (Thermo Scientific, USA) for cDNA synthesis and DreamTaq Green PCR Master Mix (2X ...
-
bioRxiv - Microbiology 2024Quote: ... previously described32 and the SuperScript III OneStep RT-PCR System with Platinum Taq DNA Polymerase kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA). Target E ...
-
bioRxiv - Microbiology 2024Quote: ... previously described32 and the SuperScript III OneStep RT-PCR System with Platinum Taq DNA Polymerase kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA). Target E ...
-
bioRxiv - Developmental Biology 2024Quote: ... and analyzed by RT-qPCR using Quant Studio 12K Flex Real Time PCR system version 1.1.2 (Applied Biosystems by Life Technologies, Thermo Fisher Scientific) and validated (efficiency > 1.8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse transcription (RT-PCR) was performed on 2-5 μg of RNA using the SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, 18080051). Real time qPCR was conducted in a 384-well PCR microplate (Fisher scientific ...
-
bioRxiv - Microbiology 2022Quote: ... 5’-/FAM/TCAAGGAACAACATTGCCAA/TAMRA/-3’) were examined by real-time RT-PCR using High Capacity cDNA Reverse Transcription kit (Applied Biosystems, 4368813) and AriaMX (Agilent ...
-
bioRxiv - Pathology 2023Quote: ... in a 384-well block was used to quantify viral RNA using AgPath- ID™ One-Step RT-PCR kit (AM1005, Applied Biosystems). The following primers and probes targeting the SARS CoV-2 N-1 gene were used ...
-
bioRxiv - Immunology 2023Quote: ... The number of SIV copies was normalized to diploid genome cell equivalents co-determined by Q-RT-PCR using the TaqMan™ RNase P Detection Reagents Kit (Applied Biosystems), as described previously (11 ...
-
bioRxiv - Microbiology 2023Quote: ... to be separated on 8% SDS-polyacrylamide gel electrophoresis (PAGE) or subjected to reverse transcriptase-polymerase chain reaction (RT-PCR) using Superscript IV (Invitrogen Life Technologies), to create cDNA and then DNA to amplify for sequencing.
-
bioRxiv - Physiology 2023Quote: ... The quantitative RT PCR assays were performed using 10 ng of cDNA with PowerUPTM SYBRTM Green Master Mix (Thermo Fisher Scientific, USA) and primers by 7500 Fast real-time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... real-time quantitative polymerase chain reaction (RT-qPCR −60°C annealing temperature) was performed with Power SYBR Green PCR Master Mix (Applied Biosystems; 4367659). Assays were run in triplicates on the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Real-time quantitative PCR (RT-qPCR) was performed in three technical replicates per sample using SYBR Green master mix (Life Technologies, 11733046) on a ViiA 7 Real-Time PCR system (AB Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... were used to obtain double-stranded cDNA using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (Invitrogen), according to manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Quantitative RT-qPCR was performed using PowerUp™ SYBR™ Green Master Mix and QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific).
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed on all patients using the SuperScript−III Platinum® One-Step qRT-PCR Kit (Invitrogen, Waltham, MA, USA). The assay was preceded by making multi-sample paraffin tissue blocks (TMA or Tissue Microarray) ...
-
bioRxiv - Microbiology 2024Quote: ... The reaction mix was prepared by adapting the manufacturer’s protocol for AgPath-ID™ One-Step RT-PCR Reagents (Applied Biosystems™): 2X RT-PCR Buffer= 1X ...
-
bioRxiv - Cell Biology 2024Quote: ... The mRNA expression levels were measured by quantitative RT-PCR using TaqMan assay probes (listed in Table 3.) with Maxima Probe/ROX qPCR Master Mix (Thermo Fisher Scientific) and readout detection by the CFX96 Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Microbiology 2024Quote: ... the viral RNA was considered for first-strand cDNA synthesis following the protocol mentioned in the one-step RT PCR kit (SuperScript™ III kit, Invitrogen, USA) consisting of various reagents from the kit inclusive of 10 μmol of each primer ...
-
bioRxiv - Immunology 2024Quote: ... qPCR was performed on an Applied Biosystems Quantstudio 5 machine using the AgPath-ID One-Step RT-PCR kit (Applied Biosystems, 4387391) and Taqman primers as per manufacturer recommendations ...
-
bioRxiv - Genetics 2024Quote: ... RT-PCR products were fractionated by electrophoresis using 6% polyacrylamide gels in 1 x TBE and Sybr safe staining (ThermoFisher Scientific, S33102). The bands corresponding to exon inclusion or skipping were quantified using ImageJ v1.47 (NIH ...
-
bioRxiv - Microbiology 2024Quote: ... One microgram of RNA was used as template for the reactions conducted using the SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (Invitrogen). Gene-specific primer sequences were employed for deriving cDNA of the CDS of NOP56 (primer FWD 5’- ATGGTGCTGTTGCACGTG-3’ and primer REV 5’- CTAATCTTCCTGGGATGCTTTATG-3’) ...
-
bioRxiv - Microbiology 2024Quote: ... levels quantitative real-time PCR (RT-qPCR) was performed as previously described22 using TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher, #4444436) and an OneStepPlus Real-Time PCR System (96-well format ...
-
bioRxiv - Molecular Biology 2021Quote: ... Additional primers were designed using Primer Express ® Software Version 3.0 (Applied Biosystems, Foster City, CA) (Supplementary Table S1 and S2) ...
-
bioRxiv - Neuroscience 2019Quote: ... Primers were designed using the Primer Express oligo design program software (Applied Biosystems, Foster City, CA). Real-time quantitative PCR was performed using the SYBR Green I assay on the ABI 7500 Sequence Detection System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... and Megaplex PreAMP Primers and then amplified using high multiplexed Megaplex Primer Pool (#4444766, ThermoFisher Scientific) and the TaqMan 2X Universal Master Mix II (#4440040 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primer extension was performed with 2 pmol of DNA gene-specific primers (5’CATGCTTAACGTAATTCAACAGAAATTATATG) by Invitrogen SuperScript III reverse transcriptase ...
-
bioRxiv - Immunology 2020Quote: ... Additional primers were designed using tools available through either NCBI (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) or OligoPerfect Primer Designer tool (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Candidate primers and probes were identified in Primer Express v3.0 (Applied Biosystems, Foster City, California, USA) or Primer3 v0.4.0 (11 ...
-
bioRxiv - Microbiology 2020Quote: ... Appropriate primer pairs and probes were selected using the Primer Express™ software (Thermo Fisher Scientific) and initial specificity was assessed by BLASTN searches against NCBI’s nucleotide database (55) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The primers and probes were designed using the program Primer Express (Perkin–Elmer, Applied Biosystems, USA). The tetherin primers amplify all three known isoforms of P ...
-
bioRxiv - Neuroscience 2022Quote: Primers and probes for gene expression studies were designed using primer express 3 software (Life Technologies),probes and primers were synthesised by Eurofins Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Gene-specific primers for qPCR were designed using PRIMER EXPRESS version 2.0 (PE Applied Biosystems, USA) with default parameters ...
-
bioRxiv - Developmental Biology 2020Quote: ... Total cDNA was obtained using oligodT primers and the ImProm-II™ Reverse Transcription System (A3800) followed by quantitative PCR using SYBR green (Thermo Scientific 4385610) and Light Cycler 480 (Roche) ...
-
bioRxiv - Cell Biology 2019Quote: ... The expression of SLC6A14/ATB0,+ was measured using specific forward/reverse primers (5’GCTGCTTGGTTTTGTTTCTCCTTGGTC3’ and 5’GCAATTAAAATGCCCCATCCAGCAC3’) and SYBR™ Green PCR Master Mix (Thermo Fisher Scientific); the amount of SLC22A5/OCTN2 and that of the housekeeping gene RPL15 (Ribosomal Protein Like 15 ...
-
bioRxiv - Cell Biology 2020Quote: ... and quantitative PCR was performed with primers specified in Table S1 and Fast Taqman 2X mastermix (Applied Biosystems/Life Technologies, Grand Island, NY) on a 7500 Fast Real-time PCR system (Applied Biosystems/Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... and quantitative PCR was performed with primers specified in Table S1 and Fast Taqman 2X mastermix (Applied Biosystems/Life Technologies, Grand Island, NY) on a 7500 Fast Real-time PCR system (Applied Biosystems/Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... Amplified 16S rDNA was obtained from each strain by polymerase chain reaction (PCR) with the universal primers in a Thermal cycler (Applied Biosystems-2720, USA). Sequencing of the amplicons was performed in an automated DNA Analyzer (ABI 3730XL Capillary Sequencers ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... under standard PCR conditions and attB forward and reverse primers (see Key Resources Table) compatible with the Gateway cloning technology (Invitrogen/Thermo Fisher Scientific) for inclusion of the insert into the pDonor201 Gateway vector (Invitrogen/Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... were PCR amplified from genomic DNA (Pf3D7) using gene-specific primer pairs (Table S1) with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... primer pairs were designed and used with 2 μl of cDNA and Fast SYBR Green PCR Master Mix (Applied Biosystems/Thermo Fisher Scientific) to detect the mRNA of EIF2AK3 (encoding PERK ...
-
bioRxiv - Immunology 2020Quote: ... primer pairs were designed and used with 2 μl of cDNA and Fast SYBR Green PCR Master Mix (Applied Biosystems/Thermo Fisher Scientific) to detect the mRNA of EIF2AK3 (encoding PERK ...