Labshake search
Citations for Thermo Fisher :
3151 - 3200 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... RT-PCR was carried out using 500 ng of total RNA in a 20 µL volume using SuperScript IV One-Step RT-PCR kit according to the manufacturer’s protocol (ThermoFisher, Cat# 12594025) with a Taqman probe specific to POSTN (Hs01566750 ...
-
bioRxiv - Plant Biology 2023Quote: ... 50 ng cDNA was used as a template for RT-qPCR using the 7500 fast real-time PCR system (Applied Biosystems). Data were analyzed by the comparative threshold cycle method (ΔCT methods) ...
-
bioRxiv - Microbiology 2023Quote: ... The amplification reaction used the SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (Invitrogen #12574018). The generated amplicons were assessed for correct amplicon base pair (bp ...
-
bioRxiv - Microbiology 2023Quote: ... Forward TCTATTACAGAGACAGCAGAGAYC Reverse CTACTGCTCCYTCACCTTTCC and probe FAM-ACAGGAGYTGKGCCGGTCCTTTC Dark Quencher with RNA UltraSense™ One-Step Quantitative RT-PCR System (Invitrogen). The PCR was as followed ...
-
bioRxiv - Cancer Biology 2023Quote: ... the RNA samples were reverse transcribed into cDNA using the SuperScript®IV RT-PCR kit (Thermo Fisher Scientific, cat: #12594100). Real-time PCR was then performed using the Applied Biosystems StepOne™ system with SYBR Green RT-PCR Master Mixes (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Levels of MET and target gene mRNAs were evaluated by real-time RT-PCR with Fast SYBR Green mix (Applied Biosystems). Relative gene expression levels were calculated using the 2-DCt method ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-PCR experiments were carried out using the High-Capacity cDNA Reverse Transcription Kit with RNase inhibitor (ThermoFisher Scientific, Massachusetts, US) with 1 μg of RNA per reaction ...
-
bioRxiv - Molecular Biology 2023Quote: Fragments were amplified directly from extracted viral RNA using the SuperScript™ IV One-Step RT-PCR System (Cat# 12594100, Invitrogen). Primers and PCR settings are listed in Tables S5 and S6 ...
-
bioRxiv - Genomics 2023Quote: The RT-qPCR reactions were carried out on 384-well plates using a QuantStudio 7 Flex Real- Time PCR System (ThermoFisher #4485701) using 10 µl reactions (2 µl of cDNA 3.7 ng/µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... All RT-qPCR reactions were run using Applied Biosystems™ Power SYBR™ Green PCR Master Mix (Thermo Fisher Scientific, US) and were analyzed (Applied Biosystems 7500 Instrument) ...
-
bioRxiv - Biochemistry 2024Quote: ... was reverse transcribed into the first-strand cDNA using the SuperScript III First-Strand Synthesis System for RT-PCR kit (Invitrogen, USA) following the manufacturer’s protocol on a Bio-Rad PCR instrument (Bio-Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... applying the required temperature gradient across the plate using the VeriFlex technology of a QuantStudio 5 RT-PCR machine (Applied Biosystems), before lysis by addition of 1% NP-40 followed by rocking at room temperature for 30 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... extracted RNA was used as a template in a cycle-limited one-step RT-PCR reaction (SuperScript IV One-Step, Thermo Fisher) using custom primers (Table 2 ...
-
bioRxiv - Microbiology 2024Quote: ... The cDNA from all pooled samples were tested for influenza A viruses by RT-qPCR using TaqMan Universal PCR Master Mix (Applied Biosystems) directed to the matrix gene76 ...
-
bioRxiv - Physiology 2024Quote: ... The mRNA expression levels were determined by real-time quantitative RT-PCR using an Applied Biosystems (QuantStudio 7 Flex, Thermofisher, USA). The sequences of specific primers are listed in Supplemental Table 1 ...
-
bioRxiv - Plant Biology 2020Quote: Full-length of the coding sequences of all 10 AtCBLs and AtCIPK16 were amplified from cDNA of Arabidopsis ecotype Columbia-0 by high fidelity PCR using primers listed in Supp Table 1 and cloned into a pCR8/GW/TOPO TA Gateway® entry vector (Invitrogen, USA) following the manufactures protocols ...
-
bioRxiv - Molecular Biology 2021Quote: The VH region of antibody 368_01_C01 was PCR amplified from pINT3 plasmid DNA using pINT3 Nco FWD (TCTCTCCACAGGCGCCATGG) and IgG1 CH1 Xho Rev (CCCTTGGTGGAGGCACTCGAG) primers using Platinum™ SuperFi II Green PCR Master Mix (Invitrogen, 12369010). The PCR product was cloned into pIONTAS1 (23 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the reverse primer containing the Sp6 promoter (5’ ATTTAGGTGACACTATAGCCTCTTCAGTTCCTTCTTCCATC-3’).The aqp1a.1 probe was generated from whole extracted cDNA at 30hpf and amplified with the primers (5’-GTCATGAACGAGCTGAAGAGC-3’) and (5’-GGGTCACTTTGAGGACATCTC-3’),incorporated into the pCR-BluntII-TOPO vector (Invitrogen, 45-0245) (containing both the SP6 and T7 promoters) ...
-
bioRxiv - Developmental Biology 2021Quote: DNA probes for the protein–DNA pull-down assay were generated by PCR using 5’-biotinylated primers and then conjugated to Dynabeads M-280 Streptavidin (Thermo Fisher Scientific). The recombinant proteins synthesized in HEK293T cells were extracted and incubated with the DNA-probe-conjugated beads in 0.5% NP-40 ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ng of cDNA were amplified by 40 PCR cycles using an inverse primer pair SuperFi II DNA polymerase (Thermo Fisher Scientific). The linear RNAs were amplified using 100 ng of cDNA for 25 cycles of PCR amplification using a corresponding primer pair ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative PCR reactions were carried out with the indicated primer pairs (Eurofins MWG Operon, 500 nM final concentration, Supplementary Table 5) and Power SYBR® Green PCR Master Mix (Applied Biosystems) and read in MicroAmp® Fast Optical 96-well plates (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative PCR reactions were carried out with the indicated exonic primer pairs (Eurofins MWG Operon, 500 nM final concentration, Table 3) and the Power SYBR® Green PCR Master Mix (Applied Biosystems) and read in MicroAmp® Fast Optical 96-well plates (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... AATGATACGGCGACCACCGAGATCTACACXXXXXXXXTCGTCGGCAGCGTC Reverse indexing primer: CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTCTCGTGGGCTCGG The indexing PCR reactions were then purified and normalized using a SequalPrep normalization plate (Thermo Fisher Scientific), followed by elution in 20 µl of elution buffer ...
-
bioRxiv - Genetics 2019Quote: ... Genomic intervals (~100–300 bp) containing the variants were amplified by PCR and unincorporated nucleotides and primers removed using ExoSAP-IT (Thermo Fisher Scientific). Traditional Sanger capillary sequencing was performed by the UTHSC Molecular Resource Center Institutional Core using the ABI Prism 3130 Genetic Analyzer system ...
-
bioRxiv - Cancer Biology 2019Quote: ... with 0.1 µM of each primer and 20 ng of genomic DNA using an Applied Biosystems 7500 real-time PCR instrument (ABI 7500; Thermo Fisher Scientific). PCR conditions were as follows ...
-
bioRxiv - Immunology 2021Quote: ... Gene expression was analyzed using primers in combination with SYBR Green® on a StepOneReal Time PCR System (Applied Biosystems, Life Technologies). The expression level of the genes of interest was determined relative to the expression of 18S rRNA ...
-
bioRxiv - Immunology 2021Quote: ... Gene expression was analyzed using primers in combination with SYBR Green® on a StepOneReal Time PCR System (Applied Biosystems, Life Technologies). The expression level of the genes of interest was determined relative to the expression of 18S rRNA ...
-
bioRxiv - Immunology 2021Quote: ... tuberculosis fragment going from gene yrbE1A to gene rv0178 was inserted by recombination into the zeocin containing plasmid were identified by PCR amplification using primers 78 and Z3 or Z1 and F7 and DreamTaq Green polymerase (Thermo Fisher Scientific). A plasmid giving the expected PCR amplification profile was retained for further analysis and named pWM431 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5μL of 1:10 diluted cDNA template were mixed with 1.3μL primers (10μM) and 6.25 μL SYBR Green PCR master mix (Applied Biosystems/Thermo Fisher Art. No. 4309155). The cycling parameters were 10 minutes at 95°C ...
-
bioRxiv - Neuroscience 2021Quote: The levels of RTN3 mRNA were validated by qRT-PCR using a pre-validated primer sequence (rat RTN3, Rn01498010_m1; cat no. 4351372; ThermoFisher Scientific, Loughborough, UK). Levels of protrudin mRNA were analysed using pre-validated primer sequences (rat Protrudin ...
-
bioRxiv - Systems Biology 2020Quote: ... and custom-designed primers with barcodes.30 Gel electrophoresis was used to remove primer dimers from the PCR products with 2% E-Gel EX Agarose Gels (Thermo Fisher Scientific), and then the PCR products were purified using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 ng of cDNA was incubated with 5 μM forward and reverse primers and 2X SYBR Green PCR master mix (Invitrogen, catalogue #4364344). Reactions were performed using an Applied Biosystems 7000 thermocycler ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was isolated from colonies with the appropriate growth phenotype and was used to amplify the ERG6 ORF in PCR with primers CAU0013J01m and CAU0014J01m (Table 2) and Phusion Green master mix per manufacturer’s instructions (Thermo Scientific, Waltham, MA). PCR amplicons were then used as templates in Sanger sequencing reactions primed with sequencing primers (Supplementary Table 2 ...
-
bioRxiv - Microbiology 2021Quote: ... Between 0.4 and 1 µL of cDNA was used with appropriate primers (Supplementary Table S7) and SYBR® Green PCR master mix (Applied Biosystems) for qRT-PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... by qPCR assays by using target-specific primers and standard SYBR Green Technology using Power SYBR® Green PCR Master Mix (Applied Biosystems). qPCR assays were run in triplicate and conducted using an Applied Biosystems StepOneTM real-time PCR system to determine the absolute quantification of individual target mRNAs ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA and primers were added to the SYBR Green PCR Master mix or by using Taq Man probe (Thermo Fisher, Carlsbad, CA). The primer oligo sequence (supplemental table ...
-
bioRxiv - Cell Biology 2021Quote: ... under standard PCR conditions and attB forward and reverse primers (see Key Resources Table) compatible with the Gateway cloning technology (Invitrogen/Thermo Fisher Scientific) for inclusion of the insert into the pDonor201 Gateway vector (Invitrogen/Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2022Quote: ... with unlabeled forward (5’-CTTGTCTGTAAGCGGATGCC) and reverse (5’-ACGCAAACCGCCTCTCC) primers and purified using a GeneJet PCR Cleanup kit (Thermo Scientific, Waltham, MA). From the forward primer the templates contained the T7A1 promoter with a transcription start site 128 bp ...
-
bioRxiv - Microbiology 2022Quote: ssrSSa and sprB were in vitro transcribed from a PCR product template T7 promoter-containing (primers listed in Table S3) with MEGAscript T7 transcription kit (Thermo Fisher Scientific). RNAs were separated on 8 % polyacrylamide-7 M urea gel electrophoresis and eluted overnight in G50 elution buffer (20 mM Tris-HCl pH7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 25 µM customized Nextera PCR primers 1 and 2 and 0.6% final concentration of 100X SYBR Green I (Invitrogen Cat #S-7563) in a thermocycler with the following parameters ...
-
bioRxiv - Bioengineering 2022Quote: ... with 500 ng of cDNA and the target primers in a total volume of 10 µl in a StepOnePlus Real-Time PCR System (Applied Biosystems, 4376600). All genes were normalized to the expression levels of GAPDH ...
-
bioRxiv - Biophysics 2022Quote: ... Transformants were selected on 60 µg/mL Gm-infused LB Lennox agar plates and the insert size was verified by PCR with Pk18-F and Pk18-R primers using Taq Polymerase (Thermo Fisher, USA). A triparental mating was performed with PA14 flgK::Tn5 to generate PA14 flgK::Tn5 ΔrhlA gene deletion ...
-
bioRxiv - Immunology 2021Quote: ... for Tcaim and Ubc or custom designed primer and probes for Il-2 and Ifn-γ (Eurofins Genomics) and TaqMan Universal PCR Master Mix (Thermo Fisher) on a 7500 Real Time PCR System (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Separate qRT-PCR analyses were performed on 10-fold dilutions of the cDNAs with the snRNA U1 and U5 primer/probe combinations using a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... Library was amplified by 10–14 cycles of PCR using indexing primers (TruSeq small RNA kit) and phusion polymerase (Thermo Fisher Scientific). Amplification product was size-selected on 6% TBE gels (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time assays were performed using the method of Corman and colleagues 22 with E gene primers and probes (IDT, Singapore) and ABI TaqMan Fast Universal PCR Master Mix (2x) (catalogue number 4352042; Thermofisher, Vilnius, Lithuania) on a Thermofisher ABI 7500 Fast Real Time PCR machine.
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR (qPCR) was carried out using primers listed in Supplemental Table S2 with the PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) on a QuantStudio 3 Real-Time PCR Instrument (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... TβRII PCR fragments were sequenced by using M13 forward and reverse primers using a capillary automatic sequencer model ABI3130XL (Applied Biosystems, USA) at the Genomic Unit of the Biotechnology Institute ...
-
bioRxiv - Pathology 2021Quote: ... UBC 814 primer generated monomorphic bands were cloned by using ‘InsTAclone PCR Cloning Kit’ as suggested by the manufacturer (Thermo Scientific, USA). As per the protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... with 500 ng of cDNA and the target primers in a total volue of 10 μL in a StepOnePlus Real-Time PCR System (Applied Biosystems, 4376600). The target genes were normalized to the expression of GAPDH ...