Labshake search
Citations for Thermo Fisher :
3301 - 3350 of 10000+ citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... the CellEvent Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) was added to the cells with complete media for 30 min in 37°C and the caspase-3/7 positive cells were measured on an Attune NXT flow cytometer (Life Technologies ...
-
bioRxiv - Pathology 2019Quote: ... Samples were analysed on NuPAGE Tris-acetate 3-8% gel (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... NativePAGE™ 3-12% Bis-Tris Protein Gels (cat#: BN1001BOX, Invitrogen) and NativePAGE™ Running Buffer Kit (cat# ...
-
bioRxiv - Cancer Biology 2019Quote: ... CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Invitrogen) was used according to the manufacturer’s protocol with modest modifications ...
-
bioRxiv - Biophysics 2019Quote: Cells were stained with TO-PRO-3 Iodide (T3605; Thermofisher Scientific) (dilution 1:2000 ...
-
bioRxiv - Biochemistry 2019Quote: ... 3 µm particle size (Thermo Fisher Scientific Inc., Waltham, MA U.S.A.) and separated using a 130 min gradient (100 min from 0% −35% Buffer B ...
-
bioRxiv - Cancer Biology 2019Quote: ... BxPC-3 cells were cultured in RPMI-1640 (Gibco, 11875-093) with 10% FBS (Corning ...
-
bioRxiv - Developmental Biology 2019Quote: ... for 3 hrs was isolated using the RNAqueous-Micro Kit (Ambion) and reverse transcribed ...
-
bioRxiv - Cell Biology 2020Quote: mIMCD-3 cellls were transfected with Lipofectamine 2000 (Thermo Fisher Scientific) and HEK293 cells with polyethylenimine (PEI ...
-
bioRxiv - Immunology 2019Quote: ... or 3×105 CD3/CD28 Dynabeads/well (ThermoFisher Scientific, Waltham, MA). Cells were incubated for up to 4 days at 37°C ...
-
bioRxiv - Genetics 2021Quote: qRT-PCR was performed using the QuantStudioTM 3 System (Applied Biosystems) set to standard curve mode in 96-well 0.1-mL block ...
-
bioRxiv - Genetics 2021Quote: Total RNA concentrations were measured on a Qubit 3 (ThermoFisher Scientific) using a Qubit RNA BR Assay Kit (Q10211 ...
-
bioRxiv - Systems Biology 2021Quote: ... Cell viability was determined by TO-PRO-3 (Thermo Fisher Scientific) staining.
-
bioRxiv - Cancer Biology 2019Quote: ... Sections were counterstained with ToPro-3 (1:1000 dilution; Life Technologies).
-
bioRxiv - Genomics 2021Quote: ... cells were washed 3 times with DPBS (Life Technologies 14190-250) then cultured in complete FluoroBrite DMEM media.
-
bioRxiv - Plant Biology 2020Quote: ... leaf discs were incubated in DiBAC4(3) (10 μM, Invitrogen B438) for 30 min and we used the excitation line at 488 nm and recovered fluorescence signal between 505 and 560 nm ...
-
bioRxiv - Neuroscience 2020Quote: ... QPCRs were performed in the Quantstudio 3 apparatus (Thermo Fisher Scientific) with GoTaq qPCR master mix 2X with SYBR Green (Promega ...
-
Cell Ecosystem and Signaling Pathways of Primary and Metastatic Pediatric Posterior Fossa EpendymomabioRxiv - Cancer Biology 2020Quote: ... cDNA concentration was measured with a Qubit 3 Fluorometer (Life Technologies). We used 10 ng of cDNA for each RT-qPCR reaction and KiCqStart SYBR Green primer pairs for GAPDH ...
-
bioRxiv - Microbiology 2020Quote: ... on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2020Quote: ... The assays were performed on a QuantStudio 3 instrument (Applied Biosystems) with the following cycling parameters ...
-
bioRxiv - Bioengineering 2021Quote: ... and a QuantStudio™ 3 Real-Time PCR System (ThermoFisher Scientific).
-
bioRxiv - Biophysics 2021Quote: ... Cells were counted using a Countess 3 FL cell counter (Invitrogen), pelleted by centrifugation for 2 min at 200 g ...
-
bioRxiv - Neuroscience 2020Quote: ... Gradient gels (3% - 8% Tris-acetate protein gels, Thermo Fisher Scientific) were loaded with the lysates and run for 55 min at 150 V in Tris-tricine buffer (50 mM Tris ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons are washed 2-3 times with Neurobasal-A medium (Gibco) prior to fixation.
-
bioRxiv - Cancer Biology 2021Quote: ... and blocked in 3% bovine serum albumin in PBS (Fisher Scientific). Cells were stained with the indicated primary antibodies for overnight in 4 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Constructs were transfected into PC-3 cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s recommended procedures and GFP containing cells were sorted by flow cytometry ...
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Neuroscience 2020Quote: ... Amplicons were analyzed in 3% agarose gels stained with SYBRsafe (Thermofisher).
-
bioRxiv - Cell Biology 2020Quote: ... and washed 3 times with 1x PBS (Fisher Scientific, BP399-1).
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed on the QuantStudio 3 (Thermo Fisher Scientific) platform and the cycling conditions were as follows ...
-
bioRxiv - Microbiology 2021Quote: ... following the manufacturer instructions in a QuantStudio 3 equipment (ThermoFisher Scientific). Primers for the normalizing gene rpsJ (F_rpsJ 5’ TGAAACGGCTAAGCGTTCTG 3’ ...
-
bioRxiv - Microbiology 2020Quote: ... and anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:5,000 dilution, Invitrogen). Secondary antibodies against rabbit and mouse IgG conjugated to IRDye 680LT or IRDye 800CW were obtained from Li-Cor (1:10,000 dilution) ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 μl UltraPure Water (Thermo Fisher Scientific, Waltham, MA, USA). Each amplification was performed in technical triplicate ...
-
bioRxiv - Cell Biology 2021Quote: ... from 2-3 µg of RNA using oligo(dT) (Invitrogen 18418012) as primer ...
-
bioRxiv - Biophysics 2020Quote: ... Cells were loaded with 10 μmol/L Fluo-3-AM (Invitrogen; 10 min loading and 30 min de-esterification ...
-
bioRxiv - Cell Biology 2022Quote: ... Blocking was performed with 3% bovine serum albumin (Thermo Scientific, # 26140079) and 2% goat serum diluted in PBS containing 0.25% Triton X-100 for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA samples were treated with 3 U of TURBO DNase (Ambion) for 15 min at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... on a QuantStudio 3 real-time PCR system (Thermo Fisher Scientific). Fold change in gene expression compared to endogenous controls was calculated using the ddCT method ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 µL 10X sample reducing agent (Life Technologies, Carlsbad, CA, USA) and heat-denaturation for 5 min at 95 °C ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.05 M of Fe(NO3)3 (Thermo Fisher Scientific Corp.) until they were approximately the same shade of blue ...
-
bioRxiv - Molecular Biology 2022Quote: ... and either TO-PRO-3-Iodide (Thermo Fisher Scientific, Waltham, MA) or DAPI (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... BxPC-3 and PSN-1 were cultured in RPMI1640 (Thermo Fisher), supplemented with 10% FCS and 1% P/S ...
-
bioRxiv - Neuroscience 2022Quote: ... The RTqPCR were perfomed using a QuantStudio™ 3 System (ThermoFisher) with SYBR Green enzyme mix (ThermoFisher PowerUp SYBR Green Master Mix) ...
-
bioRxiv - Genomics 2022Quote: ... The GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) Taqman probe (Thermo Fisher Scientific) was used as an endogenous control.
-
bioRxiv - Microbiology 2022Quote: Quantitative RT-PCR (QuantStudio 3, Applied Biosystems, Foster City, CA, USA) was performed with one-step Prime script III RT-qPCR mix (Takara ...
-
bioRxiv - Developmental Biology 2022Quote: ... After treatment with 3 U DNase I (AmpGrade; Thermo Fisher Scientific), sgRNAs were purified using High Pure PCR Cleanup Micro Kit (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... spreads were blocked in 3% BSA (w/v) (Fisher Scientific, 11483823) in PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... IBC-3 and SUM190 in Ham’s F-12 media (GIBCO, #31765092) with 1 μg/ml hydrocortisone and 5 μg/ml Insulin ...
-
bioRxiv - Microbiology 2022Quote: ... 1 nM TO-PRO™-3 Iodide (642/661 nm, Thermofisher) and 8 ng/ml calcofluor-white (CW ...