Labshake search
Citations for Thermo Fisher :
3401 - 3450 of 10000+ citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... and (3) RNA integrity analysis using Agilent 2100 analyzer (Applied Biosystems). Samples containing over 0.8 μg of total RNA and with RNA integrity number > 7.0 were sequenced ...
-
bioRxiv - Microbiology 2020Quote: ... and run on 3-12% NativePage Bis-Tris Protein Gels (Invitrogen) according to manufacturer specifications ...
-
bioRxiv - Immunology 2020Quote: ... on a QuantStudio 3 system (Applied Biosystems, Foster City, CA, USA). Relative gene expression normalized to 18S rRNA was calculated with the ΔΔ CT method.
-
bioRxiv - Immunology 2020Quote: ... run on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) using the following cycling conditions ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were quantified with a Qubit 3 Fluorometer (Thermo Fisher Scientific) using a dsDNA HS kit (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2020Quote: ... 0.05% 3-(N,N-Dimethylmyristylammonio) propanesulfonate zwittergent detergent (Acros Organics, 427740050)) containing protease inhibitor (Mammalian ProteaseArrest-APExBIO K1008) ...
-
bioRxiv - Immunology 2021Quote: ... and goat anti-mouse Cyanine 3 (Life technologies, A10521, 1:1000). Images for BrdU staining were taken using a Zeiss Confocal (LSM710 META) ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μl of DNA ladder (1 Kb Plus DNA Ladder; Invitrogen), 6 μl of positive control and 10μl of template DNA were ran on 2.5% (w/v ...
-
bioRxiv - Developmental Biology 2020Quote: ... on Applied Biosystems QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) for N=3 biological replicates ...
-
bioRxiv - Cell Biology 2021Quote: Proteins were resolved by Tris-acetate NOVEX NuPAGE 3-8% (Invitrogen) (SorLAFL and SorLA2131 ...
-
bioRxiv - Genomics 2021Quote: ... 3 washes 5x SSCT (15557044, ThermoFisher Scientific with 0.2% Tween-20), Hybridization buffer (Molecular Technologies ...
-
bioRxiv - Biophysics 2020Quote: ... 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI; Life Technologies, Carlsbad, CA), and GM1 ...
-
bioRxiv - Microbiology 2022Quote: ... equipped with a Falcon 3 direct electron detector (Thermo Fisher Scientific) for cryo-ET data collection ...
-
bioRxiv - Developmental Biology 2022Quote: ... qPCR was run using a QuantStudio 3 machine (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2022Quote: ... Using a QuantStudio 3 real-time quantitative PCR machine (Life Technologies), we measured relative amounts of specific mRNAs with SYBR green as the fluorescent dye ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μM FluoZin-3 tetrapotassium salt (Thermo Fisher Scientific, Waltham, MA) was then added to each reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... ready-made native 3–12% Bis-Tris gels were used (Invitrogen) according to instructions ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were passaged every 2-3 days using Accutase (Thermo Fisher). For experiments about 5000 cells were seeded per dish ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed 3 times with DMEM (cat. # A14430, Thermo Fisher), and then incubated for 4 hrs with HBSS (cat ...
-
bioRxiv - Biochemistry 2022Quote: ... The sample was crosslinked with 3 mM of BS3 (Thermo Fisher) for 30 minutes at 30°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CD223 (LAG-3) - APC-eFluor 780 (Invitrogen, 47-2239-42) antibodies by Cytoflex Flow Cytometer analysis.
-
bioRxiv - Biochemistry 2022Quote: ... SK-BR-3 cells were cultured in McCoy’s 5A medium (Gibco) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... The RNA was quantified using Qubit 3 Fluorometer (ThermoFisher scientific, USA) and TapeStation (Agilent Technologies 4200 ...
-
bioRxiv - Cell Biology 2022Quote: ... and resolved on a 3%-12% gradient native gel (Invitrogen, BN1001BOX).
-
bioRxiv - Genomics 2022Quote: ... DNA was quantified using the Qubit 3 and Nanodrop (Thermofisher, UK). Library preparation of genomic DNA was done using the LITE pipeline as described previously (20 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... testis from 3 days old flies were extracted in TRIzol (Invitrogen) in batches of 10 flies at a time and the testis samples were flash frozen in liquid nitrogen ...
-
bioRxiv - Immunology 2022Quote: ... 3 µl of Dynabeads MyOne Carboxylic Acid (1 μm; ThermoFisher Scientific) were added at a concentration of 0.5 mg/ml to each of the samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pSVGV (3 µg) were transfected using lipofectamine 2000 (Thermo Fisher) into HEK293T cells for lentiviral production ...
-
bioRxiv - Plant Biology 2022Quote: ... on the QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific) with standard protocol ...
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed using a QuantStudio 3 (Applied Biosystems, Waltham, MA) with the following conditions ...
-
bioRxiv - Developmental Biology 2024Quote: ... on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). Primer sequences are indicated in Appendix Table 2 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: human TASK-3 was overexpressed by transient transfection (Lipofectamine 2000 (Invitrogen)) into a HEK293 cell line stably expressing AMPK-β-1S108A mutant subunit ...
-
bioRxiv - Molecular Biology 2022Quote: ... IP samples were analyzed on 3–8% tris-glycine gels (Invitrogen). Additionally ...
-
bioRxiv - Molecular Biology 2022Quote: ... Indole-3-acetic acid (IAA) was purchased from ThermoFisher (Product #I3750). IAA treatment was performed as previously described (Zhang et al ...
-
bioRxiv - Developmental Biology 2022Quote: ... and QuantStudio™ 3 Real-Time PCR System (Applied Biosystems A28567). All primers used in qRT-PCR had primer efficiencies above 98% ...
-
bioRxiv - Cell Biology 2024Quote: ... organoids were washed 3 times with ice-cold PBS (Gibco, #14190250) and kept on ice for the entire isolation procedure ...
-
bioRxiv - Plant Biology 2023Quote: ... on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). The data were normalized using actin (Solyc11g005330 ...
-
bioRxiv - Cancer Biology 2024Quote: ... via cytocentrifugation on a Shandon Cytospin 3 Cytocentrifuge (Thermo Fisher Scientific) at 500g for 5 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by 3 PBS washes and mounting using ProLong Gold (Invitrogen) and 18mm square glass coverslips ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3% THE RNA Storage Solution (Thermo Fisher Scientific, Cat # AM7001) dissolved entirely in molecular H2O ...
-
bioRxiv - Microbiology 2024Quote: ... or a QuantStudio 3 (Thermo Fisher Scientific, Inc., Waltham, MA, U.S.A.) with two primers and probes consisting of the forward primer (5’-TGC TCA TGG TAT CAA TCT TAT CG −3’) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were fixed in 3% paraformaldehyde (PFA; #043368.9M, Thermo Fisher Scientific) for 10 min at room temperature (RT ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were detected using a QuantStudio 3 (Thermo Fisher Scientific) qPCR machine ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with TO-PRO™-3 Iodide (Invitrogen, UK) for 15 min and mounted using ProLong Glass Antifade Mountant (Thermo Fisher ...
-
bioRxiv - Immunology 2024Quote: ... cells were washed 3 times with PBS (Gibco Life Technologies,10010) for 5 min ...
-
bioRxiv - Immunology 2024Quote: ... cells were washed 3 times with PBS (Gibco Life Technologies,10010) for 5 min ...
-
bioRxiv - Genetics 2024Quote: ... and QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific). Primers for amplifying mtDNA were AGCTCATCATATATTTACCGTTGGA & AGCTGGAGAATAAGAAA-GTTGAGT ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were run on NuPAGE 3-8% Tris Acetate Gel (Invitrogen) in Tris-Acetate SDS Running Buffer (Novex) ...
-
bioRxiv - Immunology 2024Quote: ... CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher, C10423) was added to cultures at 20 μM and incubated for 30 min at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... and plates were blocked with 3% non-fat milk (Life Technologies) diluted in PBS containing 0.01% Tween-20 (PBST ...