Labshake search
Citations for Thermo Fisher :
3301 - 3350 of 10000+ citations for 6 CHLORO 4 METHYL 3 PHENYLCOUMARIN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... and Qubit 4 fluorometer (Thermo Fisher). RNA-Seq libraries were prepared using the NebNext Ultra II RNA library prep kit ...
-
bioRxiv - Neuroscience 2023Quote: ... in a Qubit 4 fluorometer (Invitrogen).
-
bioRxiv - Neuroscience 2023Quote: ... (1:300; 4 h, RT, Invitrogen) were used as secondary antibodies ...
-
bioRxiv - Developmental Biology 2023Quote: ... with Qubit 4 Fluorometer (Thermo Fisher). cDNA libraries were prepared with Ovation SoLo RNA-seq System (NuGen/Tecan Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... 4 mM L-glutamine (ThermoFisher Scientific), 5 mM HEPES buffer (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... anti-IL-4-PB (Thermo Fisher Scientific Cat# 48-0042-82 ...
-
bioRxiv - Immunology 2023Quote: ... eFluor450 anti-CD11a (M17/4, Thermofisher), BUV395 anti- CD153 (RM153 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4% B-27 supplement (Thermofisher Scientific), 30 µM L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (Sigma) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4 mM GlutaMAX (Gibco, 35050-061), 50 μM β-mercaptoethanol (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: ... 4-Chlorobenzene Sulfonate Salt (DiD, Invitrogen) before imaging ...
-
Treg cells drive MYCN-mediated immunosuppression and tumor aggressiveness in high-risk neuroblastomabioRxiv - Cancer Biology 2023Quote: ... subsequently fixed in 4% paraformaldehyde (ThermoFisher) at 4°C overnight with gentle agitation ...
-
bioRxiv - Microbiology 2023Quote: ... 4% D-glucose (Thermo Fisher Scientific)) or RPMI-1640 (10.4 g/L RPMI-1640 powder without phenol red (Merck KGaA ...
-
bioRxiv - Developmental Biology 2023Quote: ... or 4% normal donkey serum (Gibco) in PBS overnight at 4°C ...
-
bioRxiv - Genomics 2024Quote: ... and a Qubit 4 fluorometer (Invitrogen), we estimated the ssDNA molar concentration using an estimated fragment length of 60bp.
-
bioRxiv - Neuroscience 2024Quote: ... 4-20% Tris-Glycine gels (Invitrogen) were used and electroblotting carried out at 25V and 1.3A for 20 min ...
-
bioRxiv - Bioengineering 2024Quote: ... OCT-4 (701756, Invitrogen, 1:1000), TRA-1-60 Podocalyxin (14-8863-82 ...
-
bioRxiv - Cell Biology 2024Quote: ... / FM™4-64 (Invitrogen, #T13320) dyes were being used for mitochondrial/vacuolar staining ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 µl Lipofectamine 2000 (Life technologies) and 200µl Opti-MEM-l medium (Life technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... 4% in PBS (Thermo Fisher Scientific) for 20 min and permeabilized with 0.2% Triton X-100 in PBS for 5 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4%Insulin-Transferrin-Selenium (Gibco, USA)) ...
-
bioRxiv - Physiology 2024Quote: ... fixed in 4% formaldehyde (PFA, Invitrogen) for 15 min and permeabilized in 1% TritonX-100/PBS solution for 20 min at RT ...
-
bioRxiv - Bioengineering 2024Quote: ... 4% paraformaldehyde was acquired from ThermoFisher for fixation and preservation purposes.
-
bioRxiv - Neuroscience 2024Quote: ... 4% horse serum (Gibco, No. 16050), 1% L-glutamine (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... 4% B27 supplement (Thermo Fisher Scientific), 30 μM L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2024Quote: ... on the Qubit 4 Fluorometer (Invitrogen). RNA purity was measured with the Nanodrop 1000 (Thermo Fisher Scientific) ...
-
bioRxiv - Systems Biology 2024Quote: ... on a Qubit 4 Fluorometer (Invitrogen). Subsequently ...
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Immunology 2021Quote: ... iBMDMs were incubated for 3 h in 50 μM of the mitochondrial uncoupler carbonyl cyanide 3-chlorophenylhydrazone (CCCP; ThermoFisher, M20036). Control samples included ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
Interaction of the Xanthomonas effectors XopQ and XopX results in induction of rice immune responsesbioRxiv - Molecular Biology 2020Quote: The wild-type copy of the xopX gene and its 14-3-3 protein binding motif mutants were cloned in the yeast two-hybrid vector pDEST32 (Invitrogen) using the Gateway cloning system (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Genetics 2019Quote: ... V2.0 vector containing gRNA inserts targeting Kmt2d exon 51 (5’-TCTGGCTCGTTCG CGTATCC-3’) and exon 53 (5’-TCCTTTGGGGATTCGCCGGC-3’) or empty vector were transfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancerbioRxiv - Cancer Biology 2020Quote: ... supplemented with 1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindocarbocyanine (DiI)-labelled acetylated-LDL (15µg/ml, Thermo Fischer) or DiI-labelled LDL (15 µg/ml, Thermo Fisher) and incubated at 37°C for 2 hours ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Systems Biology 2021Quote: ... The Caspase-3 assay was performed on retina sections following the protocol described above (anti-caspase 3 (Fisher Scientific, 15889738) 1:500) ...
-
bioRxiv - Biochemistry 2021Quote: EB1 was amplified from pET24d-His-TEV-EB1 plasmid using the primers 5’-CACCATGGCTGTAAACGTCTACTC-3’ and 5’-TTACTTGTAGAGCTCGTCCATGC-3’ and inserted into pENTR/D-TOPO (Invitrogen). Using Gateway LR Clonase II (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA biotinylation at the 3′ end was performed using the Biotin 3’ End DNA Labeling Kit (Thermo Fisher Scientific, US) in accordance with the manufacturer’s instructions with some modifications ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Cell Biology 2021Quote: ... the mCherry-FLAG-HA-MKAKU41 gene construct was amplified using KAKUattF (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTAGCAAGGGAGAAGAGG-3’) and KAKUattR (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAGCCCGTCCCCGT-3’) primers and inserted into pDONR221 vector by BP cloning (Invitrogen), to generate the MKAKU41 entry clone ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... bovis DSM 6328 genomic DNA with the primer pair mbxA-for 5‘-AACCTTTTCTAACACAACGAGGAGAGAC-3‘ and mbxA-rev 5‘- AAATCACTAAACACTTGGAGCCAAAATTC-3‘ and cloned into the pJET1.2 vector (Thermo Scientific). Subsequently the mbxA gene was cloned into the pSU2726 hlyA vector (60 ...
-
bioRxiv - Biochemistry 2022Quote: ... target cleavage was monitored using synthetic RNA oligonucleotides radiolabeled by ligating [5′-32P] cytidine 3′,5′-bisphosphate to the 3′ end of the target with T4 RNA ligase I (Ambion). The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 150 nM v3’ template RNA (FluPolA: 5’-AGUUUGCCUGCUUCUGCU-3’, FluPolB: 5’-UAUACCUCUGCUUCUGCU-3’) and 250 µM NTP mix (ThermoFisher). 50 µM CTD peptides were added at concentrations corresponding to at least a 10-fold excess over the KD of the lowest measured affinity for a two-repeat peptide ...
-
bioRxiv - Biophysics 2022Quote: ... Texas Red-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanloamine (TR-DHPE) and Oregon Green-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (OG-DHPE) were purchased from Thermo Fisher. PLL-PEG and PLL-PEG-biotin were purchased from SuSoS AG ...
-
bioRxiv - Biophysics 2022Quote: ... Cryo-EM grids were imaged using SerialEM44 with a 3×3 image shift collection (with calibrated correction for image shift induced beam tilt) on a Titan Krios (ThermoFisher) equipped with a K3 camera and a Bioquantum energy filter (Gatan ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Molecular Biology 2022Quote: ... HDAC BamHI_FP: 5’-CGCGGATCCATGTCTAATAGAAAAAAGGTTGC-3’,and HDAC_XhoI_RP: 5’-CCGCTCGAGTTAATATGGTACAATAGATTGATCC-3 with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...