Labshake search
Citations for Thermo Fisher :
3351 - 3400 of 10000+ citations for 6 CHLORO 4 METHYL 3 PHENYLCOUMARIN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Neuroscience 2022Quote: Full length mouse Unkempt was amplified from cDNA using primers 5’-CACCAGATATCCAATGTCGAAGGGCCCCGGGCCCG-3’ and 5’-GACGACTCTAGATCACGACTGGAGGGCATGGGCCC-3’ and cloned into pENTR/D-TOPO (ThermoFisher) according to the manufacturer’s instructions to create pENTR-Unk ...
-
bioRxiv - Genetics 2022Quote: ... of a PCR amplified region of the rgr-1 locus using OneTaq 2x Master Mix (forward primer DLO1140 5’-TGGAATGGGACTTCCTCTTG-3’ reverse primer DLO1141 5’-TTTCCAAAAGCCAGGACATC-3’) isolated using a GeneJET PCR Purification kit (ThermoFisher). The rgr-1(gk429013 ...
-
bioRxiv - Immunology 2022Quote: ... burgdorferi strain B31-5A4 using the primers ((BBRecAfp (5’-GTGGATCTATTGTATTAGATGAGGCTCTCG-3’) and BBRecArp (5’-GCCAAAGTTCTGCAACATTAACACCTAAAG-3’)) with qPCR using an Applied Biosystems 7500 Real-Time PCR system (ThermoFisher) in conjunction with PowerUp™ SYBR® Green Master Mix (ThermoFisher ...
-
bioRxiv - Genomics 2019Quote: ... The 3’ end of the Ppetra cDNAs were determined with the 3 RACE System for Rapid Amplification of cDNA Ends (Invitrogen); the 5’ end of the Ppetra cDNA was determined with the 5’/3’ RACE kit 2nd generation (Roche) ...
-
bioRxiv - Neuroscience 2019Quote: Proliferating hNPCs (n=3) or differentiating immature neurons (n=3) CTX0E16s were pelleted and lysed in TRI Reagent (Ambion, AM9738). Total RNA was then extracted per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 25 μl/well of 60 mM water solution of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, Thermo Fisher Scientific) were added ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was end labelled at the 3’ end with biotin using the Pierce RNA 3’ End Biotinylation Kit (Thermo Fisher). RNA quantity was assayed by running an RNA 6000 Nano chip on a 2100 Bioanalyzer ...
-
bioRxiv - Cancer Biology 2020Quote: mRNA associated with 1 to 3 ribosomes “Light polysomes” and mRNA associated with more than 3 ribosomes “Heavy polysomes” were extracted using TRIzol LS (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... EAC11-F: 5′-TTGAATTCGACTTCGACCGCGGCGTTTT-3′ and EAC12-R: 5′-TTGAATTCATGTCTTGGCCAGGGGAGAG-3 and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). In the next step ...
-
bioRxiv - Molecular Biology 2019Quote: ... or for pre- and mature mRNAs (far-3, ZK970.7) or for pre-mRNA only (eft-3) and using StepOnePlus Real-time PCR Systems (Applied Biosystems) according to the suppliers’ protocols ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lipophilic dye DiL (DilC18(3) (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate) at 1mM stock in ethanol (Invitrogen; Carlsbad, CA, USA) was used to label nanoparticles to observe in vitro delivery ...
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... all used viruses were propagated to passage 3 on Calu-3 (ATCC HTB-55) cells in Advanced DMEM/F12 (Gibco), supplemented with HEPES ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... The carboxylic groups on the carbon fiber surface were electro-activated by incubation in 0.4 M 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC; Life Technologies) and 0.1 M and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Neuroscience 2023Quote: ... and loaded with the Fluorescent Dye-Based Rhod-3 AM following the manufactures’ instructions (Rhod-3 Calcium Imaging Kit, Cat.No. R10145; ThermoFisher scientific). Loading ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Bioengineering 2024Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (Cat. A638729) were purchased from Aladdin (Shanghai). KLH (Cat. 77600) was purchased from ThermoFisher. Peptide synthesis was conducted by Genscript (Nanjing ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Microbiology 2023Quote: ... and primers (46) (5′-CAGAGATCGATCTGTTTCCTTGACACGCGTGCCACCATGTTCGTGTTCCTG-3′ and 5′-AATCTGTGTGCAGGGCGGCCGCTCAGGTGTAGTGCAGCTTCACG-3′) and cloned by using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...
-
bioRxiv - Neuroscience 2023Quote: ... a 5040 amperometric cell and a Hypersil Gold C18 analytical column (3 μm, 100 × 3 mm; Thermo Fisher Scientific, USA). The mobile phase consisted of 0.1 M KH2PO4 buffer at pH 3.8 ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Biochemistry 2023Quote: The panel of synthetic peptide standards and the products of immunoprecipitated heparan-sulfate 6-O-sulfotransferase 1/2/3 (H6ST-1/2/3) in vitro Tyr sulfation assays were analyzed using Proteome Discoverer 2.4 (Thermo Scientific) in conjunction with MASCOT 59 against either a custom database of all (12 ...
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase 3/7 activity was assessed using the CellEvent Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Scientific, #C10427) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... A single-cell suspension from PBMC from each patient was quantified and analyzed for viability using the Cell counter 3 (Countess 3, Invitrogen) and then loaded onto the 10X Genomics Chromium Single Cell Controller for isolation of single cells (10X Genomics) ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Plant Biology 2019Quote: ... The mixture was analyzed by immunoblotting anti-6×His (Invitrogen, #MA1-135), anti-MBP (Santa Cruz Biotechnology ...
-
bioRxiv - Molecular Biology 2020Quote: ... were subsequently labeled using 6-plex tandem mass tags (Thermo Fisher Scientific) following the manufacturer’s protocol but employing a reagent to peptide ratio of four ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR was performed using FastSYBRGreen 5x MasterMix on a QuantStudio 6 (Invitrogen). Analysis was done using the ΔΔCt method using HPRT as housekeeping gene.
-
bioRxiv - Cell Biology 2020Quote: ... were seeded in 6-well plates in 1.5 ml DMEM (Life Technologies) supplemented with 10% (v/v ...
-
bioRxiv - Genetics 2021Quote: ... cells were grown in 2x YPD media (Fisher Scientific, DF0427-17-6) supplemented with 80 mg/L of adenine hemisulfate ...
-
bioRxiv - Neuroscience 2021Quote: ... in the Quant Studio 6 Flex system (Applied Biosystems, Thermo Fisher Scientific). Each sample was analyzed in duplicate ...
-
bioRxiv - Neuroscience 2021Quote: ... in the Quant Studio 6 Flex system (Applied Biosystems, Thermo Fisher Scientific). Each sample was analyzed in duplicate ...