Labshake search
Citations for Thermo Fisher :
3101 - 3150 of 10000+ citations for 6 CHLORO 4 METHYL 3 PHENYLCOUMARIN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 6 U MspI (Thermo Fisher, cat. no. ER0541, 10 U/µl) and 60 fg unmethylated lambda-DNA (Promega ...
-
bioRxiv - Biophysics 2023Quote: ... 6 parts Leibovitz L-15 medium (Gibco, Thermo Fisher Scientific, Waltham), 3 parts autoclaved double-distilled water ...
-
bioRxiv - Biophysics 2023Quote: ... 6 parts Leibovitz L-15 medium (Gibco, Thermo Fisher Scientific, Waltham), 3 parts autoclaved double-distilled water ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were pulsed with 10-6 M of EdU (ThermoFisher, C10640) in cell culture media for 2h prior to fixation.
-
bioRxiv - Cancer Biology 2023Quote: ... in a QuantStudioTM 6 Flex Real-Time PCR system (Applied Biosystems® ...
-
bioRxiv - Genetics 2023Quote: ... Cells were cultured in 6 wells plates (ThermoFisher, Cat. No. 140675) with seeding density of 0,2×106 cells and were harvested for analysis after 48 hours of incubation.
-
VapC12 ribonuclease toxin modulates host immune response during Mycobacterium tuberculosis infectionbioRxiv - Microbiology 2023Quote: ... in a QuantStudio-6 Flex Real-Time PCR System (Applied Biosystems) using the default run program ...
-
bioRxiv - Cell Biology 2023Quote: ... on the QuantStudio 6 Flex Real-Time PCR Systems (Applied Biosystems). The fold change was calculated using the 2^(−ΔΔCt ...
-
bioRxiv - Immunology 2023Quote: ... The following cytokines were measured: IL-6 (Invitrogen, #88-7064-88), IL-10 (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... a QuantStudio™ 6 Flex real-time PCR system (Applied Biosystems). Target transcript levels were normalized to those of the indicated reference genes ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μl 20× 6-carboxyfluorescein (FAM)-labeled Assay Mix (Applied Biosystems), and 9 μl of cDNA ...
-
bioRxiv - Genetics 2023Quote: ... or 2.5mM MQAE ((N-(Ethoxycarbonylmethyl)-6-Methoxyquinolinium Bromide) (Thermo Fisher, E3101) diluted in 5% sucrose overnight ...
-
bioRxiv - Physiology 2023Quote: ... in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). In mouse samples ...
-
bioRxiv - Immunology 2023Quote: ... using a QuantStudio 6 Flex Real-time PCR system (Applied Biosystems) (Glasgow) ...
-
bioRxiv - Immunology 2023Quote: ... All culture wells were supplemented with 6 mg/ml PI (Invitrogen) and were incubated at 37°C for 40 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... Transfections were conducted in 6-well format using Lipofectamine 3000 (ThermoFisher). 200 ng of reporter plasmid were co-transfected into 3T3-immortalized ...
-
bioRxiv - Cell Biology 2023Quote: ... in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). The Tbp mRNA was used as a loading control ...
-
bioRxiv - Cell Biology 2023Quote: Tubulin was labelled with (5(6)-TAMRA Succinimidyl Ester (Invitrogen, C1171) for fluorescence microscopy assays according to published methods (Consolati et al ...
-
bioRxiv - Microbiology 2023Quote: ... The reactions were run in a QuantStudio 6 Flex (Thermo Fisher) with a 95°C hold followed by 40 cycles of 95°C for 15s ...
-
bioRxiv - Physiology 2023Quote: ... Organs were then embedded in 6% agarose low melting gel (Invitrogen), and organ sections (100 μm ...
-
bioRxiv - Genetics 2023Quote: ... The protein complexes were resolved on 6% DNA retardation gels (Invitrogen) for 1 h at 100 V ...
-
bioRxiv - Immunology 2023Quote: ... Bone marrow was seeded at 1x10^6 in RPMI (Gibco,11875119)+10%FBS containing 20ng/mL of recombinant GM-CSF (PreproTech ...
-
bioRxiv - Genomics 2023Quote: ... we coated fresh 6-well plates (Thermo Fisher Scientific, cat# 140675) or/and 12-well plates (Corning ...
-
bioRxiv - Immunology 2023Quote: ... IL-6 (10 ng/ml; Thermo Fisher Scientific, Waltham, MA, USA), IL-21 (50 ng/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... on a QuantStudio 6 Flex Real Time PCR system (Life Technologies) using forward and reverse primers (NOTCH3-F CGTGGCTTCTTTCTACTGTGC ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Developmental Biology 2023Quote: ... Reactions were -treated using 6 U of Turbo DNase (ThermoFisher, UK) at 37°C for 15 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... anti-Integrin alfa-6 (ITGA6) (1:1000) (MA5-16884, ThermoFisher Scientific) for 1 h at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... or with Cultrex SCQ (Bio-techne) coated 6 well plates (Nunc). Cells were passaged as small clumps every 4 to 5 days with Dispase (Gibco) ...
-
bioRxiv - Genomics 2023Quote: ... with specific primers on a QuantStudio 6 Flex instrument (Applied Biosystems). mRNA expression was normalized to the housekeeping gene Ppib for all samples ...
-
bioRxiv - Immunology 2023Quote: ... qPCR analysis was conducted on a QuantStudio 6 (Thermo Scientific, USA) using TaqPath master mix (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and 1.8% sodium chloride (Fisher Scientific, ACS Cas.# 7647-14-6). After 20 minutes undisturbed ...
-
bioRxiv - Molecular Biology 2023Quote: ... The amplified DNA was separated by using 6% TBE gels (Invitrogen) and imaged.
-
bioRxiv - Biophysics 2023Quote: ... using the QuantiStudio 6 Flex system (Applied Biosystems: Waltham, MA, USA). Gene expression was analyzed using the ΔΔCT method ...
-
bioRxiv - Genetics 2023Quote: ... along with 6 µL of PageRuler Plus Prestained Protein Ladder (ThermoFisher) as standard and electrophoresed at 170 V using the Mini Trans-Blot cell system (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... or 6 was then used to transform into stbl3 strain (Invitrogen) for further plasmid amplification.
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were loaded onto precast 6% TBE (Invitrogen, Fisher cat #EC62655BOX) or 10% TBE-Urea (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... for detection in QuantStudio 6 Pro cycler (Applied Biosystems Carlsbad, CA). Quantification of each transcript was normalized to the mouse 18S reference gene following the 2-ΔΔCt method ((Livak & Schmittgen ...
-
bioRxiv - Neuroscience 2024Quote: ... were coated with IL-6 capture antibody (ThermoFisher Scientific, MP5-20F3) and left overnight at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... and analysed using the Quant Studio 6 Flex system (Applied Biosystems). The real-time qPCR conditions were one hold at (95 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were grown for 6 passages in DMEM-HAM’s F12 (Gibco) supplemented with 5% (v/v ...
-
bioRxiv - Biochemistry 2024Quote: ... and 0.30 M di-benzo-18-crown-6-ether (Thermo Scientific) following published protocols66,67,79,80,110 ...
-
bioRxiv - Physiology 2024Quote: ... on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) with specific primers for each gene ...
-
bioRxiv - Neuroscience 2024Quote: ... or Quant Studio 6 Pro Real-Time PCR System (Applied Biosystems). TaqMan assay details are listed in Tab ...
-
bioRxiv - Cancer Biology 2024Quote: ... The desired DNA product was purified with 6% TBE gel (Invitrogen) and samples were sequenced on an Illumina HiSeq2000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Genomic DNA was eluted 6 times in ultrapure water (Thermofisher, 10977) for maximum recovery ...
-
bioRxiv - Microbiology 2024Quote: ... Real-time qPCR was performed on QuantStudio 6 Pro (Applied Biosystems) using iTaq Universal SYBR Green Supermix (Biorad) ...
-
bioRxiv - Immunology 2024Quote: ... and real-time PCR system (Applied Biosystems 7500 QuantStudio 6 Pro). The Ct value of target genes obtained from each sample was normalized to housekeeping gene GAPDH and relative gene expression was quantified using 2-ΔΔct values.
-
bioRxiv - Microbiology 2024Quote: ... 6-5 cells were maintained in Dulbecco’s modified Eagle’s medium (Gibco) supplemented with 10% FetalPlex (Gemini Bio-Products) ...
-
bioRxiv - Immunology 2024Quote: ... and human IL-6 (Gibco, PeproTech, #200-06; 20 ng/mL). Prostaglandin E2 (PGE2 ...