Labshake search
Citations for Thermo Fisher :
3201 - 3250 of 10000+ citations for SARS CoV 2 Spike Glycoprotein S1 Sheep Fc Tag HEK293 Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... containing 10% fetal calf serum (FCS, Thermo Fisher Scientific A4766801) and 5% penicillin-streptomycin (Pen-Strep ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10% FCS and 1% penicillin-streptomycin-glutamine (Gibco).
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 10% fetal calf serum (FCS, Gibco™ 10270), non-essential amino acids (Sigma M7145) ...
-
bioRxiv - Genomics 2022Quote: ... supplemented with 15% fetal calf serum (FCS) (Thermo Fisher Scientific), 0.1mM b-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2024Quote: ... and were used fresh or after freezing in FCS (Invitrogen) containing 10% DMSO (Sigma-Aldrich).
-
bioRxiv - Microbiology 2024Quote: ... containing 4% FCS and 1% L-Glutamine (L-Gln; Invitrogen). These adherent cells were cultured to confluence for five days at 37 °C in an atmosphere containing 5% CO2.
-
bioRxiv - Cell Biology 2024Quote: ... DPBS supplemented with FCS (10% vol/vol, Gibco, #10270-106) was added to the cell suspension ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 10% fetal calf serum (FCS) and antibiotics (Gibco). All cell lines were authenticated by short tandem repeat profiling and tested for mycoplasma contamination ...
-
bioRxiv - Neuroscience 2024Quote: ... macrophages were differentiated in RPMI 1640 with 10% FCS (Gibco) containing M-CSF (100 ng/ml ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 10% heat-inactivated fetal calf serum (FCS; Invitrogen), 100 µg/ml streptomycin and 100 units/ml penicillin (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with 1 % fetal calf serum (FCS, Gibco, NY, USA) and incubated at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2023Quote: ... 10% heat-inactivated fetal calf serum (FCS, Gibco, Thermo Fisher), and 50 μM 2-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% FCS in DMEM) and 10 μg/ml DNase (Gibco) over night at room temperature (RT) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Absorbance at 540nm was measured on a Multiskan FC (ThermoFisher). A glycerol standard curve ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% fetal calf serum (FCS) (Thermo Fisher Scientific), and 50μg/ml gentamicin (PAN Biotech) ...
-
bioRxiv - Cell Biology 2023Quote: ... 15% fetal calf serum (FCS; 10500-064, Gibco, Karlsruhe, Germany), and 50 µg/ml Gentamicin (15710-049 ...
-
bioRxiv - Microbiology 2023Quote: ... absorbance was measured at 405 nm (Thermo Scientific Multiskan FC). No phosphatase activity was detected with the different PfGEXP15 proteins in absence of PP1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Absorbance was measured at 540nm utilising a Multiskan FC (ThermoFisher). The glycerol standard curve ...
-
bioRxiv - Immunology 2023Quote: ... for murine and Fc Receptor Binding Inhibitor Polyclonal Antibody (Invitrogen) for human samples and subsequently stained with live/dead cell exclusion dye (Zombie Dyes ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with heat-inactivated 10% fetal calf serum (FCS; Gibco), sodium pyruvate (1X ...
-
bioRxiv - Developmental Biology 2023Quote: ... complemented with 10% heat-inactivated foetal calf serum (FCS, Gibco), 25% H2O ...
-
bioRxiv - Developmental Biology 2023Quote: ... complemented with 10% heat-inactivated foetal calf serum (FCS, Gibco), 25% H2O ...
-
bioRxiv - Immunology 2023Quote: ... 10% heat-inactivated fetal calf serum (FCS, Gibco, Thermo Fisher), and 50 μM 2-mercaptoethanol ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 10% heat-inactivated fetal calf serum (FCS, Gibco), 200 IU/ml Penicillin ...
-
bioRxiv - Cell Biology 2023Quote: ... were grown in HL5 reinforced with 10% dialysed FCS (Gibco).
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 10% (v/v) foetal calf serum (FCS; Gibco) and 100 U/ml penicillin and 100 μg/ml streptomycin (P/S ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated with Fc block (anti-CD16/32, ThermoFisher) followed by staining with a NP311-325 IAb MHC Class II tetramer or NP366-374 H-2Db MHC Class I tetramer (generated by the NIH Tetramer Core Facility) ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% heat-inactivated fetal calf serum (FCS, Gibco) and 0.05 mM 2-mercaptoethanol ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 10% (v/v) fetal calf serum (FCS) (Gibco A5670401 ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 10 % (v/v) heat-inactivated FCS (10500064, Gibco), 100 U/ml streptomycin and 100 µg/ml penicillin (15140122 ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% (v/v) Foetal Calf Serum (FCS, Gibco) and Penicillin (100U/ml) ...
-
bioRxiv - Bioengineering 2024Quote: ... goat– anti-mouse IgG Fc-HRP (1:10,000, Invitrogen, A16084) was added for 1h at 25°C ...
-
bioRxiv - Microbiology 2024Quote: ... with 7.5% heat-inactivated Fetal Calf Serum (FCS; Life Technologies with 1% penicillin/streptomycin PS ...
-
bioRxiv - Genomics 2024Quote: ... 15% FCS (Life Technologies; Cat no. 10270106 FBS South American), 1× MEM NEAA (Life Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... DPBS supplemented with FCS (10% vol/vol, Gibco, #10270-106) was added to the cell suspension to stop TrypLE Select activity after the organoids were dissociated to a single-cell suspension ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2μl of annealing mix (5% ERCC RNA spike-In Mix (pre-diluted at 1:25,000; Invitrogen), 5% Oligo-dT (5⍰–AAGCAGTGGTATCAACGCAGAGTACT30VN-3⍰ ...
-
bioRxiv - Genomics 2020Quote: ... the reverse transcription primer and the 1:50,000 Ambion® ERCC Spike-In Mix1 (Life Technologies) were added to the lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... to which was added 1µL of 1:100 ERCC Spike-In Mix 1 (Invitrogen; Cat #4456740), commonly employed to control for cross-sample variation in library preparation ...
-
bioRxiv - Neuroscience 2020Quote: ... 2µl of diluted 1:1000 diluted ERCC Spike-in Control Mix 1 (Ambion by Life Technologies) was added to 100ng of each RNA sample prior to library construction ...
-
bioRxiv - Neuroscience 2020Quote: ... 2µl of diluted 1:1000 diluted ERCC Spike-in Control Mix 1 (Ambion by Life Technologies) was added to 100ng of each RNA sample prior to library construction ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM each dNTPs and a 1:6,000,000 dilution of ERCC RNA Spike-In Mix (Invitrogen) was added followed by incubation at 72 °C for 3 min ...
-
bioRxiv - Immunology 2022Quote: ... All fluorescently labeled antibodies and the biotinylated spike-trimer conjugated to streptavidin-allophycocyanin (SA-APC) (Invitrogen) were titrated before sorting ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µL of a 1:10 dilution of ERCC RNA Spike-in standards (Life Technologies 4456740_3674355015) was added to each nuclear fraction prior to addition of TRIzol reagent (Life Technologies 15596026) ...
-
Evolutionarily divergent mTOR remodels the translatome to drive rapid wound closure and regenerationbioRxiv - Developmental Biology 2021Quote: ... CellReports2017.fasta and concatenated to the sequences of ERCC Spike-In mix sequences (Invitrogen, ERCC92.fa) and used to build a transcript to gene reference index with RSEM version 1.2.3076 ...
-
bioRxiv - Genomics 2021Quote: ... we had additionally included 0.075μL of a 1:1,000,000 dilution of ERCC spike-in mix 1 (Ambion), as well as a control spike-in to quantify the false positive detection rate of mutations (see Figure S10) ...
-
bioRxiv - Immunology 2021Quote: ... Plasmids encoding Spike-2P and HexaPro 61 were transiently transfected in FreeStyle 293 cells (Thermo Fisher) using Turbo293 (SpeedBiosystems ...
-
bioRxiv - Systems Biology 2024Quote: ... We added 1 µl of 1:1,000 dilution of ERCC Ex-Fold Spike-Ins (ThermoFisher 4456739) to every other column of the plate to check for potential inter-sample contamination during library preparation.
-
bioRxiv - Molecular Biology 2023Quote: ... after the addition of cel-miR-39 spike-in for normalization (5 pmol/µl) (ThermoFisher Scientific). MicroRNAs and U6 small nuclear RNA (supplementary table 2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Each library preparation included 1μL of 1:250 dilution of ERCC Spike-In RNAs (Ambion #4456653). 10μL total were prepped using the KAPA RNA HyperPrep Kit with RiboErase (Kapa Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... Each library preparation included 1μL of 1:250 dilution of ERCC Spike-In RNAs (Ambion #4456653). 10μL total were prepped using the KAPA RNA HyperPrep Kit with RiboErase (Kapa Biosystems ...