Labshake search
Citations for Thermo Fisher :
3201 - 3250 of 10000+ citations for Estriol ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... quantified (QuantIT dsDNA assay kit, Invitrogen, Waltham, MA), and combined in equimolar ratios to create a sequencing pool ...
-
bioRxiv - Molecular Biology 2024Quote: ... quantified with Qubit RNA HS Assay Kit (Thermofisher) according to manufacturer’s protocol and stored at –80°C until library preparation ...
-
bioRxiv - Genetics 2024Quote: ... and Qubit dsDNA BR Assay Kit (Life Technologies).
-
bioRxiv - Genetics 2024Quote: ... and Qubit dsDNA HS Assay Kit (Life Technologies). Final library size was approximately 600-700bp ...
-
bioRxiv - Neuroscience 2024Quote: ... ERCC RNA Spike-In Mix kit (ThermoFisher #4456740) was added to normalized total RNA prior to library preparation following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... using the MirVana phenol based extraction kit (Thermofisher) as previous reported.67 Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the QuantIT RNA HS Assay Kit (ThermoFisher) and Agilent 4200 TapeStation (Agilent Technologies ...
-
bioRxiv - Genomics 2024Quote: ... and RNA BR Assay Kit (Thermo Fisher Q10210).
-
bioRxiv - Microbiology 2024Quote: ... using quant-iT BR dsDNA reagent kits (Invitrogen). When appropriate ...
-
bioRxiv - Cell Biology 2020Quote: ... One µg of total RNA was retrotranscribed into complementary cDNA using an RT-PCR kit (High capacity cDNA rt Kit, Applied Biosystems). Quantitative PCRs were carried out in triplicate of each sample using 40 ng of cDNA per well ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The fat body enriched tissues were transferred into Eppendorf with 200µL of homogenization buffer from the RNA isolation kit (MagMAX™-96 Total RNA Isolation Kit from Thermo Fisher). The tissues were homogenized and stored at -80°C until RNA extraction ...
-
bioRxiv - Developmental Biology 2020Quote: ... The libraries were profiled with High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical, #DNF-474) and measured with Qubit dsDNA HS Assay Kit (Invitrogen, #Q32851) prior to pooling and sequencing using the Illumina NextSeq 500 platform using a custom primer and the High Output v2 kit (75 cycles ...
-
bioRxiv - Developmental Biology 2021Quote: ... pregnant mice were injected intraperitoneally with 200 mg/kg body weight of 5-Ethynyl-2’-deoxyuridine (contained in the Click iT EdU Imaging Kit containing Alexa Fluor 594 as the Alexa Fluor azide (Kit #C10338; Thermo Fisher) 1 h before embryo collection at E9.5 ...
-
bioRxiv - Physiology 2022Quote: RNA was extracted from each hemi-embryo following the manufacturer’s instructions using PicoPure RNA isolation kit (PicoPure RNA isolation kit, Applied Biosystems, France), which included a DNAse treatment ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA was isolated using the RNeasy Micro kit and cDNA synthesized a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Targeted qPCR was performed using the QuantStudio 6 Real-Time PCR system using the following Taqman Primers (Applied Biosystems) ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR amplified products were run on 1.5% agarose gel and the specific amplified band was eluted using gel elution kit (GeneJET Gel Extraction Kit; Thermo Scientific, USA). Sequence determination was performed for both the strands of the DNA by Chromous Biotech ...
-
bioRxiv - Genomics 2019Quote: ... The libraries were profiled with High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical, #DNF-474) and measured with Qubit dsDNA HS Assay Kit (Invitrogen, #Q32851) prior to pooling and sequencing using the Illumina NextSeq 500 platform using custom ReadOne primer (IDT ...
-
bioRxiv - Microbiology 2019Quote: Genomic DNA was extracted using the GeneJET Genomic DNA Purification Kit while plasmid DNA was extracted using the GeneJET Plasmid Miniprep Kit (Thermo Scientific). PCR assays were performed using Phusion High-Fidelity PCR Master Mix (Thermo Scientific) ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... PCR products together with a non-template control were checked on 1% agarose gels and then cleaned with the Qiagen PCR Purification Kit and sequenced using an ABI 3130xL sequencer and the BigDye Cycle Sequencing Kit (Applied Biosystems). In total we found four mtDNA haplotypes ...
-
bioRxiv - Cancer Biology 2019Quote: ... total RNA was isolated using E.Z.N.A.® MicroElute Total RNA Kit (Omega Bio-tekkit) and transcribed into complementary DNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time PCR reactions were carried out using 1x GoTaq™ qPCR Master Mix (Promega ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... purified fosmid DNA was first fragmented into approximately 1.5 kb fragments using a Nebulizer kit supplied in the TOPO shotgun Subcloning kit (Invitrogen, Carlsbad, CA), and then sub-cloned into pCR4Blunt-TOPO vectors ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was extracted later on from each hemi-embryo using PicoPure RNA isolation kit (PicoPure RNA isolation kit, Applied Biosystems, France), which included a DNAse treatment ...
-
bioRxiv - Biophysics 2021Quote: ... Pellets were resuspended in PBS and semEV concentrations were estimated by BSA protein kit (Thermo Fisher, Pierce BCA Protein Assay Kit) and adjusted to 2mg/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... Library quality and quantification was assessed on the Agilent Fragment Analyzer using a High Sensitivity NGS Kit (DNF-474) and a Qubit 4 RNA BR kit (Thermo Fisher). Samples were then normalized to 4nM and pooled in equimolar amounts ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were sequenced using BigDye Terminator v3.1 cycle sequencing kit and cleaned with BigDye XTerminator Purification kit (Applied Biosystems, USA). Products were analysed on a 3130xl Genetic Analyzer (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: Subcellular protein fractionation and isolation of chromatin fractions was performed using the Subcellular Protein Fractionation Kit for Cultured Cells kit from Thermo Fisher, following the instructions of the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: Our metabolic click-labelling was based on the Click-iT HPG Alexa Fluor protein Synthesis Assay Kit (Click-iT HPG Alexa Fluor Protein Synthesis Assay Kit, ThermoFisher C10428) strategy ...
-
Hypoxia-mediated suppression of pyruvate carboxylase drives tumor microenvironment immunosuppressionbioRxiv - Cancer Biology 2022Quote: ... RNA was isolated (EZNA HP Total RNA kit) and cDNA was synthesized (Thermo Scientific, Verso cDNA Synthesis Kit #AB-1453/B).
-
bioRxiv - Microbiology 2021Quote: ... were performed with the Express one step RT-qPCR Universal kit (EXPRESS One-Step Superscript™ qRT-PCR Kit, universal Invitrogen) using 3.5µL of RNA and 6.5µL of RT qPCR mix and standard fast cycling parameters ...
-
bioRxiv - Immunology 2020Quote: ... RNA was purified using the Zymo RNA clean & concentrator-25 kit and quantitated using the Qubit RNA BR assay kit (Thermo Fisher). A beta release of the Collibri 3’ mRNA Library Prep Kit (Invitrogen ...
-
bioRxiv - Physiology 2022Quote: ... 20 mg of pulverized tissue were dissolved in the assay buffer from the kit as suggested by the manufacturer and normalized to protein content by Pierce™ BCA Protein Assay Kit (ThermoFisher). 250 μg of protein was used for each reaction ...
-
bioRxiv - Genomics 2019Quote: Total RNA was isolated from MOLM13 cells using the RNeasy midi kit (Quiagen) and polyA+ RNA was purified from 30μg total RNA using the Dynabeads mRNA Purification Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: Ten micrograms from each total RNA sample was treated with the MICROBExpress Bacterial mRNA Enrichment kit and RiboMinus™ Transcriptome Isolation Kit (Bacteria) (Invitrogen). Bacterial mRNAs were chemically fragmented to the size range of 200-250 bp using 1 × fragmentation solution for 2.5 min at 94°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA libraries were amplified and barcoded using Ion Total RNA-seq kit v2 and Ion Xpress RNA-seq Barcode Adapters 1-16 Kit (Thermofisher Scientific). The amplicons were quantified using Agilent High Sensitivity DNA kit before the samples were pooled in sets of fifteen ...
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA was extracted from iPSC cells using the NucleoSpin RNA kit (Machery-Nagel) and cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies). qRT-PCR was performed on all the TTLL/CCP fragments generated from primers designed in supplementary figure 5 and the housekeeping control GAPDH (GAPDHFOR 5′ − GAAGGTGAAGGTCGGAGT − 3′ and GAPDHREV 5′GAAGATGGTGATGGGATTTC − 3′).
-
bioRxiv - Physiology 2020Quote: ... HFF was processed using a exosome isolation kit (Total Exosome Isolation Kit, Invitrogen, #4484450 and Total Exosome Isolation Reagent, Invitrogen #4484453) per the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2019Quote: ... and cloned using isothermal assembly.43 Relevant plasmid sequences are included in the Supplementary Table 2 All plasmids were purified for cell-free expression using Qiagen Plasmid Midiprep Kit (Cat. 12145) and quantified by Qubit dsDNA BR Assay Kit (Invitrogen #Q32853).
-
bioRxiv - Genetics 2021Quote: ... We isolated polyA+ mRNA using the Qiagen Oligotex mRNA kit for the 1000 x 1000 ExP dataset (note this kit has been discontinued, we now use the Poly(A)Purist MAG kit from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: The amino-biotinylation of fluoxetine and RR-HNK was performed using a commercial kit (EZ-Link NHS-PEG4 Biotinylation Kit, #21455, Thermo Scientific) and the reaction monitored by mass spectrometry (Tikka et al. ...
-
bioRxiv - Immunology 2022Quote: ... or Single Cell RNA purification Kit (Norgen 51800) and reverse transcription was performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) by following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was used as a template to create labeled cDNA using MessageAmpTM Premier RNA Amplification Kit and MessageAmpTM III RNA Amplification Kit (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was isolated from cells by using a Qiagen RNeasy kit and then reverse transcribed to generate cDNA with the High Capacity cDNA kit (Applied Biosystems). Quantitative PCR was performed by using SYBR green (Quanta Biosciences ...
-
bioRxiv - Systems Biology 2020Quote: ... Extracted DNA and RNA in each sample were quantified using dsDNA HS assay kit and RNA HS assay kit on the Qubit 2.0 Fluorimeter (Life Technologies, NY), respectively.
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV2 RNA was quantified using (LabGun™ COVID-19 RT-PCR Kit) following the manufacturer’s protocol or following WHO guidelines using SuperScript™ III Platinum™ One-Step qRT-PCR Kit (ThermoFisher) and Taqman probes against CoV-2 E ...
-
bioRxiv - Cell Biology 2021Quote: ... Induced pluripotent stem cells were derived from human fibroblasts using Sendai virus-based reprogramming kit (CytoTune-iPS Sendai Reprogramming Kit; cat #. A13780-01; Thermo Fisher), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The extracts were enriched and processed for library preparation using kit Ion Total RNA-Seq Kit v2.0 (Thermo Fisher Scientific, USA) according to the manufacturer’s instructions with a minor modification ...
-
bioRxiv - Bioengineering 2022Quote: ... cDNA was synthesized from 10 ng of the total RNA with a commercially available kit (High-Capacity cDNA Reverse Transcription Kit, Thermo Fisher). Quantitative PCR (qPCR ...
-
bioRxiv - Bioengineering 2022Quote: Cell proliferation in T-SLICE zones was analyzed using an EdU (5-ethynyl-2’-deoxyuridine) Cell Proliferation Kit (Click-iT− EdU Cell Proliferation Kit for Imaging, Alexa Fluor™ 488 dye: Invitrogen). Cell culture media was supplemented throughout with 10 uM EdU ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were purified using the Qiagen miRNeasy kit and resulting concentrations were measured using Qubit RNA Broad Range Assay Kit (Thermo Fisher) and the Qubit Fluorometer (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were sequenced using BigDye Terminator v3.1 cycle sequencing kit and cleaned with BigDye XTerminator purification kit (Applied Biosystems, USA). Products were analyzed on a 3130xl Genetic Analyzer (Applied Biosystems ...