Labshake search
Citations for Thermo Fisher :
3101 - 3150 of 10000+ citations for Estriol ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Superscript III kit (ThermoFisher Scientific, Waltham, MA, US) and RNAsin Plus (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... Colloidal Blue Staining Kit (Invitrogen, Carlsbad, CA, LC6025)
-
bioRxiv - Biochemistry 2023Quote: ... and a TOPO cloning kit (Thermo Fisher Scientific) as previously described (16 ...
-
bioRxiv - Microbiology 2023Quote: ... the TURBO DNase (TURBO DNA-free kit, Invitrogen) was used according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and a Qubit dsDNA BS assay kit (Invitrogen), respectively ...
-
bioRxiv - Plant Biology 2023Quote: ... pENTR™/D-TOPO® Cloning Kits (Invitrogen) and Gateway® technology (Invitrogen ...
-
bioRxiv - Physiology 2023Quote: ... measured with a BCA Assay Kit (Thermo Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... or CytoTune iPS 2.0 Sendai Reprogramming Kit (ThermoFisher) (line TSP23-9) ...
-
bioRxiv - Neuroscience 2023Quote: ... Qubit ssDNA Assay Kit (Thermo Fisher Scientific, Q10212) was used to quantify the constructed libraries ...
-
bioRxiv - Immunology 2023Quote: ... Dynabeads™ Protein A Immunoprecipitation Kit (Invitrogen #10006D) was used ...
-
bioRxiv - Genomics 2023Quote: ... DNA concentration measured with Qubit HS kit (Invitrogen) and DNA size was validated by Femto Pulse System (Agilent).
-
bioRxiv - Cell Biology 2023Quote: ... Alexa Fluor 488 tyramide SuperBoost kit (ThermoFisher, B40922) were used ...
-
bioRxiv - Microbiology 2023Quote: ... A Museek DNA fragment library preparation kit (ThermoFisher) was used to tagment genomic DNA and was then purified with AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Systems Biology 2023Quote: ... using a DNA HS assay kit (Thermofisher #Q32851) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Pierce BCA Protein Assay Kit (Thermo scientific, 23225), protease inhibitor (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Taqman MicroRNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the Gateway LR Clonase II kit (Invitrogen). Integrity and orientation of inserts was checked further by Sanger sequencing before using plasmids to generate transgenic Drosophila.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... TRIzol (Ambion),TURBO DNA-free Kit (Invitrogen),RevertAid First Strand cDNA Synthesis kit (Thermo scientific).
-
bioRxiv - Microbiology 2023Quote: ... using the Maxima SYBR Green kit (Thermo Scientific). Oligonucleotides used for qRT-PCR are listed in Supplementary Table S2 ...
-
bioRxiv - Genomics 2023Quote: ... using the MEGAScript T7 transcription kit (Invitrogen, AMB13345). The amplified RNA (aRNA ...
-
bioRxiv - Microbiology 2023Quote: The Live/dead BacLight Bacterial Viability Kit (Invitrogen) was used according to manufacturer’s instructions with stationary phase R ...
-
bioRxiv - Microbiology 2023Quote: ... and the Qubit dsDNA HS Assay Kit (Invitrogen).
-
bioRxiv - Genomics 2023Quote: ... and the Qubit dsDNA HS kit (Invitrogen #Q32854). Libraries were sequenced on an Illumina NextSeq 500 at a target depth of 4-8 million reads ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... The Qubit RNA HS Assay Kit (Invitrogen #Q32855) was used to quantify RNA and the High Capacity cDNA Reverse Transcription Kit (Invitrogen #4368813 ...
-
bioRxiv - Molecular Biology 2023Quote: Northern blotting was performed using NorthernMax kit (Invitrogen) with adaptations as described ...
-
bioRxiv - Molecular Biology 2023Quote: ... Broad Range Assay Kits (Thermo Fisher Scientific, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... using the mMESSAGE mMACHINE T7 Kit (Ambion, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... using SYBR Green Master kit (Thermo Fisher Scientific) supplemented with 0.5 µM of specific primers (sequences are detailed in supplemental Tables S1 and S2) ...
-
bioRxiv - Cancer Biology 2023Quote: ... A cDNA synthesis kit (Applied Biosystems, Waltham, MA) was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... It was transcribed by MEGAshortscript Kit (AM1354, Invitrogen) from PCR product which was amplified following reported protocol (Vejnar et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... The BCA Protein Assay Kit (Thermo Fisher, USA). Roswell Park Memorial Institute (RPMI ...
-
bioRxiv - Cell Biology 2023Quote: ... Pierce BCA Protein Assay kit from Thermo Scientific and TAG kit from Biosino Bio-technology and Science Inc ...
-
bioRxiv - Cell Biology 2023Quote: ... and quantified with dsDNA HS assay kit (Invitrogen) on a Qubit 3 fluorometer (Invitrogen) ...
-
bioRxiv - Genomics 2023Quote: ... DNA concentration measured with Qubit HS kit (Invitrogen) and DNA size was validated by Femto Pulse System (Agilent).
-
bioRxiv - Genetics 2023Quote: ... cDNA made using Verso cDNA Synthesis Kit (ThermoFisher) as per kit recommendations ...
-
bioRxiv - Genetics 2023Quote: ... using the miRVana miRNA Isolation Kit (Invitrogen, #AM1561) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... using a Qiagen miniprep kit (Thermo Fisher Scientific). Both the δ insert and pET28 plasmid were digested with the restriction enzymes XbaI and BamHI (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... plasmid 46757)74 using mMESSAGE mMACHINE transcription kit (Thermofisher Scientific). Constant oligomer (5’AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATT TTAACTTGCTATTTCT AGCTCTAAAAC-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... or the Superscript IV transcription kit (ThermoFisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... the Pierce BCA Protein Assay kit (Thermo Scientific) was used.
-
bioRxiv - Neuroscience 2023Quote: ... using Collibri™ Library Quantification Kit (ThermoFisher # A38524100). Final pooling was based on the concentrations as measured by the Collibri quantification method and samples were sequenced on an Illumina MiSeq Sequencer using a MiSeq Reagent Nano Kit with 30% PhiX spike-in control and 400 nt forward read with output of both indexes.
-
bioRxiv - Neuroscience 2023Quote: ... commercial labeling kits were used (A20181/6, ThermoFisher Scientific and Pierce ...
-
bioRxiv - Molecular Biology 2023Quote: ... or the PureLink RNA Mini Kit (ThermoFisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The Click-iT EdU kit (ThermoFisher, no. C10340) AF+647 was used according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: The LIVE/DEAD Viability/Cytotoxicity Kit (Invitrogen: L3224) was used following the manufacturer’s instructions to evaluate cell survival ...
-
bioRxiv - Immunology 2024Quote: ... ArCTM Amine Reactive Compensation Bead Kit (Thermofisher, A10346) were used for GhostDyeTM Live/Dead stain ...
-
bioRxiv - Genomics 2024Quote: ... The TURBO DNase-free kit (Thermo Fisher Scientific) was used to remove genomic DNA contamination following instructions of the manufacturer ...
-
bioRxiv - Cell Biology 2024Quote: ... using ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Qubit dsDNA HS or BR Assay Kits (ThermoFisher), and gel electrophoresis before library construction ...
-
bioRxiv - Cell Biology 2024Quote: ... using the SuperScript VILO cDNA Synthesis Kit (Invitrogen) at 25°C for 10 min ...