Labshake search
Citations for Thermo Fisher :
3001 - 3050 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and Random primers (Thermo Fisher). RealQ Plus 2X Master Mix (Amplicon ...
-
bioRxiv - Cell Biology 2023Quote: ... oligo dT20 primers (Invitrogen 79654); dNTPs (NEB N0447L)
-
bioRxiv - Cell Biology 2024Quote: ... oligoDT(18) primers (Thermo Fisher). cDNA was amplified using primers from IDT and PowerUp SYBR Green master mix (Thermo Fisher ...
-
bioRxiv - Cell Biology 2024Quote: ... Random Hexamer Primers (Thermo Fisher), oligoDT(18 ...
-
bioRxiv - Cell Biology 2023Quote: ... Primers were obtained from ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... and Oligo(dT) primers (Invitrogen) per the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... random hexamer primer (ThermoFisher, #SO142) was mixed with total RNA (300 ng) ...
-
bioRxiv - Immunology 2023Quote: ... or Primer Express 2.0 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... using specific primers (Applied Biosystems), (Supplementary Table S2) ...
-
bioRxiv - Microbiology 2023Quote: ... Random primers (Invitrogen™, #48190011); SYBR green master mix (Dongsheng Biotech ...
-
bioRxiv - Immunology 2023Quote: ... with custom-designed primers (ThermoFisher). Comparative qPCR reactions were run on the Roto-Gene Q (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... with predesigned primers (Invitrogen, 4331182) (Primers’ Assay IDs ...
-
bioRxiv - Immunology 2023Quote: ... primers (500 nM, Life Technologies) and nuclease-free water ...
-
bioRxiv - Cell Biology 2023Quote: ... with random primers (Invitrogen 48190011). A full-length Sfrp1 cDNA fragment was obtained by PCR amplifying mouse kidney cDNA using PrimeStar HS DNA polymerase (Takara Bio ...
-
bioRxiv - Genomics 2023Quote: ... using polydT primers (Thermo Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... with random primers (Life Technologies). VH and VK regions were recovered using the first PCR primer sets (Table S1 ...
-
bioRxiv - Immunology 2023Quote: ... Primers were order from ThermoFisher.
-
bioRxiv - Genetics 2022Quote: ... random primers (Invitrogen 48190-011), dNTPs (Fermentas R0186) ...
-
bioRxiv - Developmental Biology 2023Quote: ... invariant reverse primer (ThermoFisher, desalted): 5’-AAAAGCACCGACTCGGTGCCACTTTTTCA AGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’.
-
bioRxiv - Developmental Biology 2023Quote: ... and oligo dT primers (Invitrogen). RT-PCR primers (below ...
-
Engineered autocrine signaling eliminates muscle cell FGF2 requirements for cultured meat productionbioRxiv - Bioengineering 2023Quote: ... Primers were: 18S (ThermoFisher #Hs03003631), Pax3 (ThermoFisher #Bt04303789) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Random Hexamer primers (Invitrogen). RT-qPCR was performed using the LightCycler 480 Instrument II (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: Custom primers were purchased from Sigma Aldrich and Taqman primers from ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... with random primers (Life Technologies). VH and VK regions were recovered (35 ...
-
bioRxiv - Immunology 2023Quote: ... and Oligo(dT) primer (Invitrogen). VH and VL-only transcripts were amplified using the FastStart High Fidelity PCR System (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... and random primers (ThermoFisher Scientific). The reaction was processed for 90 minutes at 37°C and then stored at -20°C.
-
bioRxiv - Neuroscience 2024Quote: ... and oligo dT primer (Invitrogen). Real-time qPCR was performed using Sybr select master mix and 7500 Real-Time PCR system from Applied Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... using random hexamer primers (Invitrogen), OligodT (New England BioLabs ...
-
bioRxiv - Neuroscience 2024Quote: ... 50 ng random primers (Invitrogen) and H2O were added to each cell to a volume of 16 μl ...
-
bioRxiv - Physiology 2024Quote: ... and primer pairs (Invitrogen, USA) listed in Table 1 ...
-
bioRxiv - Immunology 2024Quote: ... random hexamer primer (Thermo Scientific), dNTPs mix (NZYTech ...
-
bioRxiv - Microbiology 2024Quote: ... Primers were synthesized by Invitrogen.
-
bioRxiv - Plant Biology 2020Quote: ... Gene expression analysis by reverse transcriptase (RT)-quantitative (q) PCR was performed on total RNA isolated using Trizol reagent (Invitrogen, Inc.) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... Five micrograms of total purified RNA was enough for the reverse transcription reactions using the SuperScript III First-Strand Synthesis System for RT-PCR (Life Technologies). The RT-qPCR reactions for all samples were done using Power SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... 8 μL of template was used in a 25 μL reaction using the AgPath-ID One-Step RT-PCR Reagents kit (Applied Biosystems) with 0.2 μM each primer and 0.06 μM probe ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL of template was used in a 20 μL reaction using the Path-ID Multiplex One-Step RT-PCR Kit (Applied Biosystems) with 0.4 μM of each primer and 0.2 μM of each probe ...
-
bioRxiv - Developmental Biology 2021Quote: ... Amplification and fluorescence detection of RT-qPCR were carried out on Applied Biosystems QuantStudio Flex 7 Real Time PCR System (ThermoFisher Scientific). The ΔΔCT method was used for relative quantification of target cDNA abundance representing mRNA expression level normalized to Rn18s (18S rRNA).
-
bioRxiv - Cell Biology 2020Quote: ... The RT-PCR reactions were performed using predesigned single tube TaqMan gene expression assays and were analysed with the 7900HT fast RT-PCR System (Applied Biosystems). Data were studied using RQ Manager Software (Applied Biosystems).
-
bioRxiv - Immunology 2021Quote: ... Samples were loaded in triplicate and were run according to the manufacturer’s settings on a BioRad CFX Connect RT-PCR machine using power SYBR Green master mix (Thermo Fisher Scientific) and QuantiTech primers (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... Partial amplification of AIV-M gene was done using SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen, Germany) and generic real-time reverse-transcription PCR (RT-qPCR ...
-
bioRxiv - Neuroscience 2021Quote: ... Extracted RNA was converted into complementary DNA (cDNA) and amplified by RT-PCR using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) and a random primer mix (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... and reverse transcription was performed as described previously [10] Quantitative RT-PCR was performed according to manufacturer’s instructions (TaqMan, PE Applied Biosystems Instruments) on an ABI PRISM 7700 sequence detection system (Applied Biosystems Instruments) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl of each sample was used for qRT-PCR analysis utilizing the TaqPath 1-step RT-qPCR master mix CG (Applied Biosystems) and the primer set spanning a target region of 68bp for HCoV-OC43 as reported (20) ...
-
bioRxiv - Molecular Biology 2019Quote: ... All RT products were used in total of 300 ul (50 uL × 6) PCR reaction with Phusion polymerase (Thermo Fisher Scientific) and gene specific primers with Fluidigm mmPCR adaptor sequences51 ...
-
bioRxiv - Microbiology 2019Quote: ... Influenza RNAs were reverse transcribed and amplified using the superscript III One-Step RT PCR Platinum Taq High Fidelity DNA Polymerase (ThermoFisher, 12574030) and A(H3N2 ...
-
bioRxiv - Immunology 2019Quote: ... Total RNA was extracted by chloroform as described in Quantitative RT-PCR and using a PureLink RNA Mini kit (Life Technologies). RNA-Seq library preparation and sequencing by an Illumina NextSeq was conducted by the HMS Biopolymers Genomic Facility.
-
bioRxiv - Plant Biology 2019Quote: ... First-strand cDNA was synthesised from 5 μg of total RNAs using the SuperScript First-Strand Synthesis System for RT-PCR (Life Technologies), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: Amplification was performed with real-time quantitative polymerase chain reaction (RT-qPCR) in a 25μL reaction mixture using the SYBR® Green PCR Master Mix (Applied Biosystems) and 0.2 μM of each primer ...
-
bioRxiv - Neuroscience 2021Quote: ... and placed in the QuantStudio 6 Pro Real-Time PCR system (all reagents for RT-qPCR were purchased from ThermoFisher Scientific). The PCR cycle protocol was ...
-
bioRxiv - Physiology 2020Quote: ... Gene expression was performed by quantitative real time RT-PCR using Taqman gene expression assay was performed using StepOnePlus detection system (Applied Biosystems) with a standard protocol ...