Labshake search
Citations for Thermo Fisher :
3101 - 3150 of 10000+ citations for 9 10 Dihydro 4H benzo 4 5 cyclohepta 1 2 b thiophen 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... cells were incubated with secondary antibodies for 2 hours at RT in a humid chamber and DNA was counterstained with 0.1 µg/ml of DAPI (DNA intercalator, 4’,6-Diamidino-2-Phenylindole, D1306, Invitrogen). Coverslips were mounted with ProLong Diamond Antifade (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 ug of EV protein content were separated on a 4-12% Bis-Tris gel (Thermo Scientific, Rockford, IL), then blotted onto a PVDF membrane ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were washed with SSCT and incubated with 600 nM 4′,6-Diamidin-2-phenylindol (Dapi, D1306, Thermo Scientific) for 10 minutes before final washing in SSCT ...
-
Entorhinal cortex vulnerability to human APP expression promotes hyperexcitability and tau pathologybioRxiv - Neuroscience 2024Quote: ... 2/3rd of the eluted protein samples were resolved on a 4–12% Bris-Tris gel (Invitrogen: cat# NW04125box) and subjected to Silverstein (Pierce™ Silver Stain Kit ...
-
bioRxiv - Genetics 2019Quote: ... 1×10^5 cells were then lysed in RIPA buffer (ThermoFisher, 899000) containing protease and phosphatase inhibitors (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... and cultured (5-10 x 105 cells ml-1) in RPMI (GIBCO) supplemented with 15% FBS (Hyclone ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA was extracted from 4h and 24h stimulated primary neurons using TRIzol reagent (Life technologies) and following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were incubated with alpha-bungarotoxin conjugated with Alexa594 (α-btx594, 4h; Thermo Fisher Scientific) to stain the acetylcholine receptors (AChRs) ...
-
bioRxiv - Microbiology 2023Quote: ... coli DH5α or One Shot® ccdB SurvivalTM 2 T1R (Invitrogen) for plasmids containing the ccdB containing Gateway cassette were used.
-
bioRxiv - Neuroscience 2024Quote: ... with 2% heat-inactivated FBS Certified One Shot (Gibco, A38400-01) and 1x N-2 supplement (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Genomics 2021Quote: ... Samples were transferred to 1.5 mL safe-lock tubes containing one scoop of acid-washed glass beads (<106μM) and 1 mL TRIzol (Invitrogen) containing 20μg/mL GenElute-LPA (Sigma-Aldricht ...
-
bioRxiv - Molecular Biology 2019Quote: ... Antibody-bound chromatin was captured with magnetic beads for 1 h at 4°C (50 μl 1:1 mixture of Dynabeads Protein A and Dynabeads Protein G, Invitrogen). DNA from both input and ChIP samples was then extracted using phenol/chloroform ...
-
bioRxiv - Molecular Biology 2022Quote: ... We ligated both with an insert:vector ratio of 1:4 using Ligase (Thermo Scientific; 1 h, 22 C). The ligation mix was purified (Zymo Research ...
-
bioRxiv - Developmental Biology 2019Quote: ... at 4°C for 1-3 days followed by secondary antibody (1:500, Thermo Fisher Scientific #A-21206) overnight at 4°C.
-
bioRxiv - Cell Biology 2020Quote: ... Vacuolar membranes were stained with 1 μL of 1 mg/mL solution of FM 4-64 (T3166; Invitrogen) in DMSO added at the beginning of incubation of cells in YPD medium ...
-
bioRxiv - Cell Biology 2024Quote: ... AlexaFluor 488 anti-rabbit (1:1000, green) and 568 anti-mouse (1:1000, red) (both Invitrogen; Table 4) secondary antibodies were also diluted in 1% BSA and 10 % goat serum in TBS and incubated in the dark for 45 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4 μL Tris pH 6.5 1 M and 1 μL Proteinase K (20 mg/ mL, Thermo Fisher Scientific) and incubated shaking for 3 hours at 45°C ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary antibodies were incubated at 4°C overnight (Abcam, ab138501, 1:1,000; Thermo Fisher Scientific, AM4302, 1:5,000). Horseradish peroxidase-conjugated secondary antibodies were incubated for 1 hr at room temperature (Abcam ...
-
bioRxiv - Microbiology 2021Quote: ... 5% CO2 in HMI-9 medium supplemented with 20% heat inactivated Foetal μg/ml streptomycin (Gibco). Cell lines were µg/ml G418 (parental ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented either with 5 gm/L AlbuMax I (for 3D7, R539T and RKL-9; Gibco, USA) or 10% heat inactivated human A+ serum (for NF54 ...
-
bioRxiv - Immunology 2019Quote: ... was carried out in 10 mM Tris-HCl – 1 mM EDTA buffer (pH 9) in +99°C for 20 min (PT Module; Thermo Fisher Scientific). Tissue peroxide quenching with 0.9% H2O2 for 15 min was followed by protein blocking with 10% normal goat serum (TBS-NGS ...
-
bioRxiv - Pathology 2024Quote: For routine qPCR analyses 100 mg of grey matter from the STR and the CTX (Brodmann’s area 9/10) of human brains (Table 1) was dissected and extracted in 1.5 ml Trizol reagent (ThermoFisher/Life Technologies, 15596026) using a hand-held homogenizer (6 x15 s bursts)(Pro-Scientific ...
-
bioRxiv - Cell Biology 2020Quote: Whole protein extracts were prepared from JJN3 pellets (4°C, 150 x g, 5 min) according to the cell extraction protocol for ELISA sample preparation by ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: Thymi from 4-week-old wild type mice were harvested and 5 million thymocytes per condition were cultured in IMDM medium (Gibco) with 2% FBS (HyClone Thermo Fischer Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... produced from DKO piglet were prepared and stained at 4°C for 45 minutes with Alexa 488-conjugated Griffonia simplicfolia isolectin IB4 (GS-IB4) (5 μg/mL, Invitrogen). The stained cells were washed twice and then analyzed by flow cytometer (BD Accuri™ C6 Plus) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were boiled at 95°C for 5 min before running on a NuPAGE 4-12% Bis-Tris protein gradient mini gel (Invitrogen) at 200 V for 5 min in MOPS running buffer (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: Neuronal suspensions were labelled at 37°C with a combination of the Fluo-4 calcium indicator (5 μg/ml; Invitrogen) and either Alexa-Fluor 594-coupled Wheat Germ Agglutinin (WGA ...
-
bioRxiv - Cell Biology 2019Quote: ... 10-15% of RIPA-soluble fraction and 2.5-5% of insoluble fraction were loaded on 4-12% Bis-Tris gels and run using MOPS buffer (Life Technologies) and visualized by western blotting on PVDF ...
-
bioRxiv - Genetics 2020Quote: ... For morphological analyses 105 cells were resuspended in 200 ml PBS and spun (5 min, 400 rpm) in a Cytospin 4 (ThermoFisher), before staining with modified Wright’s Stain on a Hematek (Bayer Health Care) ...
-
bioRxiv - Genetics 2021Quote: ... 100 µL of the cell suspension were then placed in a cytofunnel and spun at 1200 rpm for 5 min with high acceleration using a cytocentrifuge (Shandon Cytospin 4; ThermoFisher). For FISH ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were heated to 50°C for 5 minutes before being loaded on 4-12% Novex WedgeWell Tris-Glycine gels (ThermoFisher).
-
bioRxiv - Bioengineering 2021Quote: ... 10 µg of each sample was boiled at 95°C for 5 min and loaded onto the 4-12% Bis-Tris Gel (NP0336, ThermoFisher). Gels were run for 1 hour and 15 min at 120 V in with NuPage MES Buffer (NP0002 ...
-
bioRxiv - Biophysics 2021Quote: Cells were magnetically labelled thanks to an incubation of 2h with a solution of iron oxide nanoparticles at [Fe] = 4 mM and supplemented with 5 mM citrate in RPMI medium (Gibco). The viability and the proliferation of cells after magnetic labelling were assessed by Alamar Blue showing no impact of the magnetic labelling right after the labelling or after one day (Supplementary Figure 1).
-
bioRxiv - Biochemistry 2021Quote: ... and samples were incubated at 70°C for 5 minutes and loaded onto Bis-Tris 4-12 % gradient gels (ThermoFisher). Bands were stained by CBB and relative band intensity was quantified by scanning and semi-automated analysis in ImageQuant (GE Healthcare).
-
bioRxiv - Immunology 2020Quote: ... and anti-CD127-PE-Cy5 (clone eBioRDR5; 5 μL; cat. # 15-1278-42) all from Thermo Fisher (Supplementary Fig. 4). mAbs for chemokine receptors (i.e ...
-
bioRxiv - Cell Biology 2021Quote: ... 5–12 µl of protein lysate was loaded into pre-cast protein gels (4–12 % Bolt Bis Tris Plus, ThermoFisher) together with 10 µl of the molecular marker (PageRuler prestained ...
-
bioRxiv - Cell Biology 2021Quote: ... Human islets were loaded with 5 µg/µL of the Ca2+-sensitive dye Fluo-4 (1923626, Invitrogen, Thermo Fisher Scientific) for 60 min before being transferred to a recording chamber ...
-
bioRxiv - Cell Biology 2021Quote: ... Human islets were loaded with 5 µg/µL of the Ca2+-sensitive dye Fluo-4 (1923626, Invitrogen, Thermo Fisher Scientific) for 60 min before being transferred to a recording chamber ...
-
bioRxiv - Systems Biology 2021Quote: ... and samples were centrifuged at 16,000g for 5 minutes at −4°C in a Sorvall Legend Micro 17R microcentrifuge (Thermo Scientific). The supernatant (extract ...
-
bioRxiv - Cell Biology 2021Quote: ... samples were boiled for 5 minutes in NuPage LDS sample buffer and run on NuPage Bis-Tris 4-12% protein gels (Invitrogen), and proteins were transferred to PVDF membranes (Immobilon-FL ...
-
bioRxiv - Pathology 2022Quote: ... for 5 min at 95 °C before they were loaded in Bolt™ 4–12 % Bis-Tris gels (Thermo Fisher). After separation ...
-
bioRxiv - Biochemistry 2022Quote: ... A total of 405 WT peptides were identified (Table 4) on the Fusion Lumos OrbiTrap mass spectrometer (mass tolerance <5 ppm) using Proteome Discoverer 2.2.0 software (Thermo Fisher Scientific).
-
bioRxiv - Biochemistry 2022Quote: ... to final concentration 0.5 mg/ml protein and 6x dye and heated from 10 to 70 °C with fluorescence reading every 0.1 °C (4 to 5 sec) in a QuantStudioTM 7 Flex Real-Time PCR System (Life Technologies). Protein thermal melting curve were generated using the Protein Thermal Shift TM software ...
-
bioRxiv - Bioengineering 2022Quote: ... Samples were boiled at 95°C for 5 min and loaded on SDS-PAGE (NuPAGE 4-12% Bis-Tris, Invitrogen). Efficiency of ligand coupling to the Ad capsid (% total hexon protein coupled ...
-
bioRxiv - Cell Biology 2022Quote: ... and cells were passaged every 4-5 days using 0.5 mM EDTA (pH 8.0) (Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Bioengineering 2022Quote: ... The dissociated cells and tissue fragments were centrifuged at 1,000 rpm for 5 mins at 4 ℃ and cultured in a T75 tissue-culture flask in a growth medium (advanced DMEM/F12 (Gibco) containing 5% bovine serum (Gibco)) ...
-
bioRxiv - Cell Biology 2020Quote: ... proteins were transferred onto a nitrocellulose membrane and then blocked overnight while shaken at 4 °C in TBST-5% BSA—a TBS Tween-20 (TBST; ThermoFisher) solution containing 5% bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was isolated from groups of 5 HIOs per replicate with a total of 4 replicates per infection condition using the mirVana miRNA Isolation Kit (ThermoFisher). Cytosolic and mitochondrial ribosomal RNAs were removed from samples using the Ribo-Zero Gold Kit according to manufacturer’s protocol (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: Hemolymph sporozoites collected on days 19 to 24 post-infection were centrifuged for 5 min at 450 x g and 4 °C in an 8-well Lab-Tek chamber slide (Nunc) or a 384-well plate (Greiner) ...