Labshake search
Citations for Thermo Fisher :
3051 - 3100 of 9391 citations for Mumps Virus Nucleoprotein Strain L Zagreb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Both RSV strains were propagated on HEp-2 cells (ATCC, CCL-23) cultured in DMEM (Gibco) supplemented with 5% FBS (Gibco) ...
-
bioRxiv - Immunology 2022Quote: Listeria monocytogenes EGD (BUG600 strain) was grown in brain heart infusion (BHI) broth (#10462498, Fisher Scientific) shaking at 37□°C ...
-
bioRxiv - Genomics 2022Quote: The 42 Kluyveromyces lactis strains were inoculated into flat bottom 96-well microplates (Nunclon, Thermo Fisher) containing 150 μL of YPD (Yeast extract 1% Peptone 2% Dextrose 2% ...
-
bioRxiv - Microbiology 2022Quote: ... coli XL1-Blue strain cultured in Luria-Bertani (LB) broth (Thermo Fisher Scientific, Waltham, MA, USA) aerobically at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... The strain was maintained in complete 7H9 media supplemented with 30 μg/ml kanamycin (Fisher Scientific). Mtb mc26206 expressing tdTomato (Mtb-RFP ...
-
bioRxiv - Microbiology 2024Quote: Glycerol stock of Escherichia coli (E. coli) (TOP10 strain, Invitrogen, Thermo Fisher Science, Waltham, MA, USA) transformed with plasmid pCR2.1 (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μl of the respective strain were spotted on a 1% PBS-agarose (select agar, Invitrogen). Fluorescence microscopy was performed as described previously (42) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse zygotes (C57BL/6N strain) were injected with 200 ng/μl CAS9 protein (IDT and ThermoFisher), 100 ng/μl Tgfbr2-specific sgRNA (AGGTCAAGTCGTTCTTCACT) ...
-
bioRxiv - Microbiology 2023Quote: ... aureus (HIP10787 mupA positive QC strain Methycilin Resistant) sourced from Thermo Scientific (LENEXA, KS 66215 USA) were independently inoculated into a 10 ml Luria Broth (LB ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA from each strain was quantified using the Qubit DNA Broad Range assay (ThermoFisher Scientific), diluted to the same concentration (10 ng/μL ...
-
bioRxiv - Biophysics 2023Quote: The hpt1Δ (MatA, his3Δ1, leu2Δ0, met15Δ0, ura3Δ0, hpt1::KanMX) Saccharomyces cerevisiae yeast strain was from Invitrogen. The cells were cultured in synthetic complete (SC ...
-
bioRxiv - Biochemistry 2023Quote: P.pastoris strain X-33 and the vector pPICZα C were purchased from Invitrogen (Thermo Fisher Scientific). E.coli XL-10 cells were provided by STRATAGENE EUROPE.
-
bioRxiv - Molecular Biology 2023Quote: AJY4049 was made by integrating PmeI-cut pAOL47-04 into a TIF6-GFP-expressing strain (Invitrogen). AJY3027 was constructed by sequential crossing appropriate haploid strains originally derived from the heterozygous deletion collection (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: The bacterial strains used in this work unless otherwise stated were as follows DH5α (ThermoFisher Scientific). The plasmids and primers that were used in this study can be found in table 1 ...
-
bioRxiv - Microbiology 2024Quote: ... and the ΔmelH complemented strain were determined using a BacLight Bacterial Membrane Potential Kit (ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... the strains were streaked out and grown on Remel Porphyrin Test Agar (PTA, Thermo Fisher Scientific), and/or blood agar (BA ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 and HEK293T cells were obtained from ATCC and grown at 37°C/5% CO2 in Dulbecco’s Modified Eagle Medium (4.5 g/L glucose and L-glutamine, no sodium pyruvate) from Thermo Fisher Scientific (Cat #11965118 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pyruvate DMEM (4.5 g/L D-glucose, 110 mg/L sodium pyruvate; Gibco™ Thermo Fisher Scientific, Waltham, Massachusetts) supplemented with 10% heat inactivated FBS (Gibco™ Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... culture media was removed from cells and replaced with 50μl imaging media (L-15 media without Phenol Red containing L-glutamine (Gibco), 1% FBS and 10μM 9-cis retinal) ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 10% (vol/vol) Fetal Clone III (HyClone) and 2 mM GlutaMAX (L-alanyl-L-glutamine dipeptide in 0.85% NaCl, Gibco). Cells are checked annually for mycoplasma contamination and were authenticated through mass spectrometry (the protein sequences exactly match those in the African green monkey genome) ...
-
bioRxiv - Microbiology 2020Quote: ... and resuspended in fresh DMEM-10 (Gibco DMEM #11995-065 with 4.5 g/L D-Glucose and 110 mg/L Sodium Pyruvate, 10% Fetal Bovine Serum [HyClone], 1% HEPES [Gibco 1M 15630-080] ...
-
bioRxiv - Bioengineering 2022Quote: ... were cultured in 24-well culture plates in DMEM culture media (4,5 g/l glucose, L-Glutamine) supplemented with 10% fetal calf serum (Gibco) and 1% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 10% (vol/vol) Fetal Clone III (HyClone) and 2 mM GlutaMAX (L-alanyl-L-glutamine dipeptide in 0.85% NaCl, Gibco). COS-7 cells were transfected using TransIT-LT1 transfection reagent (Mirus) ...
-
bioRxiv - Bioengineering 2022Quote: ... hADSCs were plated in 75 cm2 tissue culture treated flasks at a density of ~5000 cells/cm2 in growth media consisting of DMEM/F12 with L-Glutamine and 2.493 g/L sodium biocarbonate (Gibco) supplemented with 10 % fetal bovine serum (Wisent Bioproducts ...
-
bioRxiv - Biophysics 2022Quote: ... The PDMS chamber was perfused with L-15 cell culture medium (Leibovitz’s L-15 Medium, Gibco™, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... except they were plated and maintained using media that consisted of 1x DMEM (+4.5g/L D-glucose and L-Glutamine, Gibco), Pen-strep and 10% FBS ...
-
bioRxiv - Microbiology 2021Quote: ... were cultivated in Dulbecco Modified Eagle medium containing 4500 mg/L high glucose (1X) with 4.0 nM L-glutamine without sodium pyruvate (Gibco), and supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10% (vol/vol) Fetal Clone III (HyClone) and 2 mM GlutaMAX (L-alanyl-L-glutamine dipeptide in 0.85% NaCl, Gibco). Cells are checked annually for mycoplasma contamination and were authenticated through mass spectrometry (the protein sequences exactly match those in the African green monkey genome) ...
-
bioRxiv - Biophysics 2019Quote: ... on reverse-phase columns (trapping column: particle size 3μm, C18, L=20mm; analytical column: particle size <2μm, C18, L=50cm; PepMap, Dionex/Thermo Fisher). Peptides were eluted in gradients of water (buffer A ...
-
bioRxiv - Genetics 2019Quote: ... from 3 independent subjects were obtained from the bone marrow of children undergoing osteotomy and cultured in growth medium which consisted of: DMEM containing L-Glutamine (61965-059) and 4.5 g/L Glucose (Gibco), with the addition of 10 % hyclone (SH30070.03) ...
-
bioRxiv - Biochemistry 2019Quote: ... and then incubated in 25ml of pre-warmed Dulbecco modified Eagle medium (4.5 g/L glucose with L-glutamine) containing 2 mg/mL collagenase (Invitrogen) in 50 ml tubes ...
-
bioRxiv - Plant Biology 2019Quote: ... Rh (10 µg L-1) and Ir (5 µg L-1) in 2% trace analysis grade (Fisher Scientific, UK) HNO3 ...
-
bioRxiv - Pathology 2020Quote: ... Transfection with SMARTpool siRNAs targeting Nck1 (L-006354) and Nck2 (L-019547; IDT) was performed using Lipofectamine 3000 (Invitrogen) according to the manufacture’s recommendations ...
-
bioRxiv - Cell Biology 2019Quote: ... were maintained in cDMEM (100 U/ml penicillin/streptomycin, 100 μg/ml streptomycin, 2 mM L-glutamine, 10 % FBS, 3.7 g NaH2CO3/L, pH7.2; ThermoFisher Scientific) and cRPMI-1640 (100 U/ml penicillin/streptomycin and 10 % FBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... U2OS and HEK-239T cells were grown in DMEM containing 2.5 mM L-glutamine and 4.5 g l-1 D-glucose (Life Technologies). H1299 cells were grown in RPMI 1640 medium containing 2.5 mM L-glutamine.
-
bioRxiv - Biophysics 2020Quote: ... supplemented with 10% (vol/vol) Fetal Clone III (HyClone) and 2 mM GlutaMAX (L-alanyl-L-glutamine dipeptide in 0.85% NaCl, Gibco). Cells are checked annually for mycoplasma contamination and were authenticated through mass spectrometry (the protein sequences exactly match those in the African green monkey genome) ...
-
bioRxiv - Genomics 2019Quote: ... Intact 12 day-old seedlings were transferred in 8 mL of 1% liquid MS media (4.4 g/L MS salts mixture, 10 g/L D-sucrose) in 6 well-plates (Nunc) and allowed to acclimate for 48 hours with mild agitation (130 rpm).
-
bioRxiv - Biochemistry 2022Quote: ... cells were cultured in high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM) containing L-glutamine and 110 mg/L sodium pyruvate (Gibco, ThermoFisher Scientific) supplemented with 10% tetracycline-free fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2022Quote: ... the growth media was replaced with high-glucose Dulbecco’s modified Eagle’s medium containing L-glutamine and 110 mg/L sodium pyruvate (Gibco, ThermoFisher Scientific) and 10% tetracycline-free fetal bovine serum (Wisent ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were maintained in a humidified 37° C incubator with 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, MilliporeSigma) supplemented with 2 mM L-Glutamine (L-Glu, Gibco), 0.1 mM non-essential amino acids (NEAA ...
-
bioRxiv - Bioengineering 2022Quote: ... Imaging medium consisted of phenol-free DMEM (4.5 g l-1 glucose, L-glutamine, and 25 mM HEPES, 21063-029, Invitrogen) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2022Quote: ... Vero E6 TMPRSS2 cells were maintained in DMEM with 4.5 g/L glucose and 2 mM L-glutamine (Gibco), 10% heat-inactivated FBS (R&D Systems) ...
-
bioRxiv - Plant Biology 2022Quote: ... 50 L loosened peat and 25 L coarse vermiculite) and maintained in a growth chamber (Invitrogen, Clayton, Missouri, USA) under a light period of 16-hour at 25 °C and relative humidity of 60-80% ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were maintained in a humidified 37° C incubator with 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, MilliporeSigma) supplemented with 2 mM L-Glutamine (L-Glu, Gibco), 0.1 mM non-essential amino acids (NEAA ...
-
bioRxiv - Immunology 2023Quote: ... The Aedes albopictus mosquito-derived cell line C6/36 was maintained at 28°C in a BOD in Leibovitz’s L-15 medium (L-15) (Gibco) supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... Live imaging medium for cell lines consisted of phenol red-free DMEM (4.5 g l-1 glucose, L-glutamine, and 25 mM HEPES, #21063-029, Invitrogen) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2023Quote: Kidneys were harvested and transferred to MEM with Earle’s Salts (with 2.2 g/l NaHCO3, without L-Glutamine) medium (Biochrom) supplemented with 10% FCS (Life Technologies), 1x Non-Essential Amino Acids (NEAA ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was resuspended in 1 ml of DMEM before adding the mixture to a 6-well plate containing 2 ml of DMEM with 4.5 g/L D-Glucose and L-Glutamine (Gibco) supplemented with supplemented 10% FBS ...
-
bioRxiv - Bioengineering 2023Quote: MCF7 cells were cultured in full DMEM medium (Dulbecco’s modified Eagle Medium 1x with added 4.5 g/L D-glucose, L-glutamine and pyruvate, from Thermo Fisher), supplemented with 10% fetal bovine serum ...
-
bioRxiv - Bioengineering 2022Quote: ... was dissolved in 1.4□L of MilliQ water (Barnstead Smart2Pure 3 L UV/UF water purification system, Thermo Scientific) with 14.16□g of HEPES acid (STREM Chemicals ...