Labshake search
Citations for Thermo Fisher :
3051 - 3100 of 10000+ citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... cells were incubated with 5-ehtynyl-2’-deox-yuridine (EdU: Invitrogen, Thermo Fisher Scientific) at 10 µM ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were incubated with 5-ehtynyl-2’-deox-yuridine (EdU: Invitrogen, Thermo Fisher Scientific) at 10 µM ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2×10^5 individualized hESCs were resuspended in 10 μL Resuspension Buffer R (Invitrogen) containing CRISPR ribonucleoproteins (Cas9 protein+sgRNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 mM DTT and 5 U/mL SUPERase.In RNase Inhibitor(Thermo Fisher Scientific #AM2696)) on ice and post-nuclear extracts placed on top of 10-50% weight/volume sucrose gradients containing the same buffer (apart from no Triton X-100 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The target cells were treated with 5 mg/ml MMC (#BP2531-2, Fisher Scientific) for 90 minutes at 37°C and then washed twice with RPMI medium before adding to the T cells at a 2:1 ratio (CAR T:MMC treated cells) ...
-
bioRxiv - Developmental Biology 2021Quote: Fish were incubated with 0.1 mg/ml of 5-ethynl-2-deoxyuridine (Thermo Fisher) in embryo media for 2 hours prior to harvesting at 98 hpf ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 hours and 5 hours using a Floid Cell Imaging Station (Thermo Fisher Scientist), and then manually counted for quantification ...
-
bioRxiv - Evolutionary Biology 2023Quote: We performed experimental evolution using SM/5 media [56] (2 g glucose (Fisher Scientific), 2 g BactoPeptone (Oxoid) ...
-
bioRxiv - Developmental Biology 2023Quote: Cell proliferation assays were conducted employing 5-Ethynyl-2′-deoxyuridine (EdU; ThermoFisher Cat# C10337), a thymidine analog ...
-
bioRxiv - Cancer Biology 2022Quote: ... mice underwent intraperitoneal injection (IP) with 5-ethynyl-2`-deoxyuridine (EdU) (component A, Invitrogen™ Click-iT™ EdU Cell Proliferation Kit for Imaging ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 5 µg / µl 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) and slides were mounted with FluoromountG (SouthernBiotech).
-
bioRxiv - Cell Biology 2023Quote: ... Cy-2- or Cy-5-conjugated goat anti-mouse secondary antibodies (Thermo Fisher Scientific) were used at a 1:750 dilution in 5% HIGS/PBS ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Genetics 2023Quote: ... 2×10^5 individualized iPSCs were resuspended in 10 μL Resuspension Buffer R (Invitrogen) containing CRISPR ribonucleoproteins (Cas9 nuclease +sgRNA ...
-
bioRxiv - Neuroscience 2023Quote: ... then they were incubated for 2 h in 5% normal donkey serum (NDS, Gibco), 0.2% Triton-X100 in PBS to block nonspecific binding ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... in an atmosphere of 5% CO2 in an automatised incubator (Cytomat 2, Thermo Fisher). All experimental replicates were performed on a different day ...
-
bioRxiv - Physiology 2024Quote: ... 25 μM Cy5-hydrazide with 10 mM 2-amino-5-methoxybenzoic acid (ThermoFisher Scientific) in 1xPBS as a catalyst was added to the cells for 15 minutes at room temperature to allow complete conjugation with the aldehyde ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cells were treated with 20 μM 5-ethynyl-2′-deoxyuridine (EdU, Invitrogen, A10044) for 1 hour in the presence or absence of 10 μM mtOX 53 or 6 μM DMBA (Selleck Chemicals ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μl of Novex Hi-Density TBE 5 x sample buffer (Thermo Fisher Scientific) was mixed with 8 μl of the EMSA reaction and loaded on an 8.0% agarose gel ...
-
bioRxiv - Systems Biology 2024Quote: ... at a ratio of 2:5 into HEK293FT cell with lipofectamine 3000 (ThermoFisher, L3000008) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... The nanoLC system was equipped with an Acclaim™ Pepmap™ 100 C18 nano-trap column (1×2 cm, 5 μm particle size, Thermo Scientific, USA) and an Acclaim™ Pepmap™ 100 C18 analytical column (length 15 cm ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were rinsed with 0.025% Triton X-100/1xTBS 2 × 5 min and incubated in goat anti-rabbit AlexaFlour488 secondary antibody (1:1000, Life Technologies, #A27034, Carlsbad, CA) at RT for at least 2 h followed by 4’,6-diamidino-2-phenylindol (DAPI ...
-
bioRxiv - Plant Biology 2023Quote: ... Peptides were reconstituted in 0.1% trifluoroacetic acid (TFA) and 2% acetonitrile (ACN) and loaded onto a PepMap C18 5 µm 1 cm trapping cartridge (Thermo-Fisher Scientific, Waltham, MA, USA) at 12 µL/min for 6 min before switching the pre-column in line with the analytical column (nanoEase M/Z Peptide BEH C18 Column ...
-
bioRxiv - Immunology 2024Quote: ... slides were rinsed with 0.025% triton X-100 in TBS (2 × 5 min) and incubated in goat anti-rabbit AlexaFluor488 secondary antibody (1:1000, Life Technologies, #A27034, Carlsbad, CA) or goat anti-rat AlexaFluor594 secondary antibody (1:1000 ...
-
bioRxiv - Physiology 2024Quote: ... were aspirated using a 21-gauge needle attached to a 5 mL disposable syringe in the presence of 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-buffered TCM-199 medium (Gibco, Life Technologies, Milan, Italy) and 0.005% (w:v ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2022Quote: ... dihydro-chloride (DAPI) (Invitrogen. Cat. Nº: D3571) at 0.5 µg/µl ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 µL deoxynucleotides (dNTPs) and 1 µL of RevertAid H Minus-MuLV reverse transcriptase (ThermoFisher Scientific) were added to a final volume of 20 µL ...
-
bioRxiv - Cancer Biology 2021Quote: ... incubated for 2 h with anti-rabbit IgG conjugated to Alexa-555 (1:200, Life Technologies) in PBT-BSA at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed tissues were incubated for 2 hours with Alexa Fluor 546 Phalloidin (ThermoFisher Scientific 1:400) in PBS-0.1% Triton X-100 (PT) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-2 µg of cDNA was diluted into 100 µl of Opti-MEM I Medium (Invitrogen) and mixed gently ...
-
bioRxiv - Developmental Biology 2020Quote: ... Remaining of the plasmid was digested with 1 μl TURBO DNase (2 U/μl, ThermoFisher Scientific) for 15 min at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 kPa polyacrylamide gels were made using 2 μL of blue fluorescent beads (200 nm; ThermoFisher), 18.8 μL of 40% acrylamide solution (cat no ...
-
bioRxiv - Developmental Biology 2022Quote: ... incubated 2 hours in a 1:250 dilution of TRITC-conjugated phalloidin (Molecular Probes, Eugene, OR), and subsequently imaged on a Zeiss LSM 700 confocal microscope.
-
bioRxiv - Neuroscience 2021Quote: ... slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Life Technologies D-21490, 1:2000) for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... The nuclear dye 4’,6-diamidino-2-phenylindole (DAPI) at 1 l ng/ml (Molecular Probes) was added to visualise all cells ...
-
bioRxiv - Physiology 2020Quote: ... Cell nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000; ThermoFisher, Table S13). Confocal images were acquired using an inverted laser scanning confocal microscope (Nikon Eclipse C1) ...
-
Plant Trans-Golgi Network/Early Endosome pH regulation requires Cation Chloride Cotransporter (CCC1)bioRxiv - Plant Biology 2021Quote: ... plants were germinated in 2 mL of media placed in 1-well microscopy slides (Thermo Fisher) and grown vertically ...
-
bioRxiv - Bioengineering 2021Quote: ... and placed into a 2 mL Eppendorf tubes filled with 1 mL of RPMI 1640 (Gibco), 50 µM 2-mercaptoethanol (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were counterstained with 1/2500 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, ThermoFisher Scientific, USA). The cover slips were fixed in fluorescence mounting medium (Fluoromount-G ...
-
bioRxiv - Cancer Biology 2020Quote: ... HBEC3-KT cells were incubated with 1 μM of 2’-7’-dichlorofluorescin diacetate (CM-H2DCFDA; Invitrogen) for 30 min at 37°C ...
-
bioRxiv - Physiology 2021Quote: ... Adipogenic media for days 1-2 contained: DMEM with 4.5 g/L glucose (Thermo Fisher Scientific), 10% calf serum (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: ... 40 mg tissue sample or 1×105 cultured cells were homogenized in 2 mL Trizol (Invitrogen), and then 1 mL chloroform was added ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% chick embryo extract (CEE,E.G.G. Technologies) and 1% (v/v) Penicillin/Streptomycin (P/S, Gibco), and 20 U/ml gamma interferon (γFN ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 µL of cells is spotted on a 2 percent low melting agarose pad (Invitrogen 16520050) made with 1X PBS ...
-
bioRxiv - Microbiology 2020Quote: ... the spike-in culture was aliquoted in a 1:2 ratio with RNAlater™ solution (Invitrogen) on ice and stored at -80 °C.
-
bioRxiv - Systems Biology 2020Quote: ... Non-transduced cells were eliminated by 72 h treatment with 2 μg mL−1 puromycin (Gibco).
-
bioRxiv - Neuroscience 2020Quote: ... the lysates were incubated for 1 hour with 2 μg anti-GFP antibody (Thermo Fisher Scientific) and then incubated at 4°C for 30-60 minutes with Protein A Dynabeads (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were counterstained with 1/2500 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, ThermoFisher Scientific, USA). The cover slips were fixed in fluorescence mounting medium (Fluoromount-G ...
-
bioRxiv - Microbiology 2021Quote: ... cells were overlayed with DMEM containing 2% FBS and 1% Anti/Anti (#15240062, Thermo Scientific, USA). Plates were incubated for 7-10 days before being observed for cytopathic effect (CPE) ...