Labshake search
Citations for Thermo Fisher :
2801 - 2850 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... 1 μl of the DNA was subjected to PCR with primers BT-1F and BT-1R (Table S3) using Kapa Biosystems HiFi HotStart ReadyMix (Thermofisher Scientific) with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Round 1 PCR was carried out for 10 cycles with oMF321 and oHP139 (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAAGGACCCAAACGAAAAG primers using Phusion polymerase (F530, Thermo Fisher) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... cDNAs were mixed with primer pairs and amplified using SYBR green master mix and the 7900HT Fast real-time PCR system (Applied Biosystems). Iμ ...
-
bioRxiv - Neuroscience 2019Quote: ... Primer efficiencies for real-time quantitative PCR (qPCR) experiments were calculated using cycle threshold (CT) values (SYBR® Green; Life Technologies) derived from five ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 0,25 μM of forward and reverse primers (Table S5) on a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Biochemistry 2019Quote: ... 0.5 μL Pfu Ultra DNA polymerase and 0.4 μM of each of the appropriate forward and reverse primers (Supp. Table 1).PCR amplification was performed in a Veriti 96-well thermocycler (Applied Biosystems) programmed as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... the amplicons obtained with forward and reverse PCR primers were sequenced with the Sanger method in an ABI3500 (Applied Biosystems™). The DNA used for the different PCRs were purified by using the Wizard® Genomics Kit (Promega).
-
bioRxiv - Molecular Biology 2020Quote: ... according to manufacturer’s instructions using the custom primer panels for the first PCR and the Ion AmpliSeq™ HD Dual Barcode Kit (Thermofisher) for the second PCR ...
-
bioRxiv - Genetics 2020Quote: ... Diluted cDNA was used in triplicate quantitative PCR reactions with pre-tested gene specific primers and qPCRbio SYgreen Blue Mix using a QuantStudio 5 (Applied Biosystems) thermal cycler ...
-
bioRxiv - Genomics 2021Quote: ... A real-time qRT-PCR was performed with the gene-specific primers of selected genes using SYBR Green at the 7900 HT Fast Real-Time PCR System (Applied Biosystems) following the method established in our laboratory [21] ...
-
bioRxiv - Microbiology 2021Quote: ... Relative quantification using standard curve method on the input was performed for each primer pair and 96-well Optical Reaction plates were read in a StepOnePlus PCR instrument (Applied Biosystems). Fold enrichments were calculated as fold inductions relative to the values measured with IgG ...
-
bioRxiv - Microbiology 2021Quote: ... 20 ng cDNA in a 20 μL reaction and primers at 1 μM final concentration on a QuantStudio 12K Flex Real-Time PCR System (Applied Biosystems). Primer specificity was ensured by designing primers to span exon-exon junctions ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA in the vicinity of the rs7143400 was amplified by PCR using the following primers 5’-GGTTGGGTGTGAATAGGAAT-3’ and 5’-TGCATGCCTGATTTATTTGG-3’ before digestion with Tsp45I enzyme (Thermo Scientific). Finally ...
-
bioRxiv - Bioengineering 2021Quote: ... 0.25μL GoTaq Flexi DNA Polymerase, 10 μM of each primer (IDT, USA) and 20 μL of DNA in an ABI PCR instrument (Applied Biosystems). The PCR conditions were as follows ...
-
bioRxiv - Bioengineering 2021Quote: ... nanobody sequences were PCR amplified with primers containing terminal regions of homology for cloning into a pRset plasmid (Addgene plasmid 3991)(Invitrogen, V35120) in frame and linked to mCherry ...
-
bioRxiv - Neuroscience 2021Quote: ... 5μL of 1:10 diluted cDNA template were mixed with 1.3μL primers (10μM) and 6.25 μL SYBR Green PCR master mix (Applied Biosystems/Thermo Fisher Art. No. 4309155). The cycling parameters were 10 minutes at 95°C ...
-
bioRxiv - Plant Biology 2021Quote: ... the full-length coding region of GmRAV was amplified by PCR using GmRAV-TOPO-F and GmRAV-TOPO-R primers (Table S2) and cloned into pENTR/D-TOPO (Life technologies) and then transferred to the expression vector pDEST15 vector through LR reaction to generate the GST-GmRAV fusion vector ...
-
bioRxiv - Neuroscience 2020Quote: ... Template DNA was PCR amplified from plasmids using M13 forward and reverse primers and Phusion high-fidelty DNA polymerase (Thermofisher F530S). The target product was gel purified using the NucleoSpin mini-spin columns (Machery-Nagel 740609.50) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR fragments were amplified using appropriate primer pairs (Tables S2 and S3) and Phusion High-Fidelity PCR Master Mix with GC Buffer (Thermo Scientific). Linear fragments were purified on agarose gels ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... Primers listed in Table S8 were used for introducing mutations by inverse PCR with Phusion High-Fidelity DNA Polymerase (Thermo Fisher). pICH41155::NRC2 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were precipitated (NH4Ac and ethanol) and sequenced using amplification primers on an ABI Prism 3100 capillary sequencer (Applied Biosystems).
-
bioRxiv - Biochemistry 2022Quote: The custom oligonucleotide array (1 μL) was amplified with primers for internal p8 coat protein display and Phusion High-Fidelity PCR Master Mix (Thermo Scientific).
-
bioRxiv - Immunology 2022Quote: ... in 384 well plates with 0.5 μM forward and reverse primers (sequences in Supplementary table 1) run on a Viia7 Real-Time PCR machine (Thermo Scientific). Fold induction of the target gene was calculated relative to GAPDH in human cells and Hprt in murine cells.
-
bioRxiv - Microbiology 2022Quote: RT-qPCR for YFV detection was performed as previously described [17] using primers and probe targeting the YFV NS3 gene [23] on an ABI 7500 Fast Real-Time PCR System (Applied Biosystems). Absolute quantification was based on standard curves generated from 5-fold serial dilutions of YF17D cDNA with a known concentration.
-
bioRxiv - Molecular Biology 2020Quote: ... Mice with the recombined allele were identified using PCR and diagnostic primers using genomic DNA extracted from ear biopsies (4403319 DNA Extract All Reagents Kit, Life Technologies) as the template for short range PCR using Platinum® Taq DNA Polymerase (10966034 Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... Reaction samples contained ~10ng cDNA and 0.5 μM primers in Power SYBR Green PCR Master Mix (Applied Biosystems, Thermo Fisher Scientific) and samples were tested in duplicate ...
-
bioRxiv - Microbiology 2020Quote: ... Reaction samples contained ~10ng cDNA and 0.5 μM primers in Power SYBR Green PCR Master Mix (Applied Biosystems, Thermo Fisher Scientific) and samples were tested in duplicate ...
-
bioRxiv - Neuroscience 2021Quote: ... The double phosphosite mutant construct pME:kitbY568F/Y570F was made by PCR using pME:kitb as a template and the kitb 568/570Y-F IVA F and R primers with the Phusion High-Fidelity PCR Kit (ThermoFisher Scientific) followed by in vitro assembly in Top10 competent cells (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: Real-time PCR was performed using primers (Integrated DNA Technologies, Coralville, IA, USA) and probes (Thermo Fisher Scientific, Waltham, MA, USA) with sequences and concentrations listed in Table 1 in combination with QuantiTect Multiplex PCR Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: ... Amplification of cDNA was performed with sequence specific primers as follows (Table 1) and SYBR Green PCR master mix (Thermo Fisher) on Step One Plus Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Genetics 2022Quote: ... 0.3 pmol/μL of each primer and 12.5 μL 2X Power SYBR Green I PCR Master Mix (Applied Biosystems, Warrington, UK). The thermocycling conditions were as follows ...
-
bioRxiv - Developmental Biology 2022Quote: ... with cDNA (diluted 1:5) and gene-specific primers (Key Resources Table) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) in triplicate ...
-
bioRxiv - Developmental Biology 2022Quote: ... with cDNA (diluted 1:10) and gene-specific primers (Key Resources Table) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) in triplicate ...
-
bioRxiv - Developmental Biology 2022Quote: Mice were genotyped with 50 ng DNA purified from ear punch or tail clips using the primers described in the original reports and Phire Tissue Direct PCR Master Mix (Thermo Scientific) according to manufacturer’s recommendations.
-
bioRxiv - Plant Biology 2019Quote: ... region [33] was done with primer pairs DC6/ITS4 [34] and for the PvCOX2 gene using the primer pairs previously described [35] using the Phusion High-Fidelity PCR Master Mix (Thermo Scientific) supplemented with 0.25 µM of each primer ...
-
bioRxiv - Plant Biology 2019Quote: ... GUSPlus was amplified by PCR using Gateway specific primers and cloned in pDONR™/Zeo via BP clonase (Thermo Fisher Scientific). The PCR was performed following manufacturer’s instructions for Invitrogen™ Platinum™ SuperFi™ Green PCR Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2020Quote: ... 200 ng of the PCR product and forward primer for the studied gene (described above) was used for sequencing using a Sequence Scanner (Applied Biosystems). The results were analysed using the BioEdit program (Ibis Biosciences ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and PCR amplification with virus candidate specific primers using the Platinum™ SuperFi™ DNA polymerase (Invitrogen™, Catalog number: 12359010). Amplified products were Sanger sequenced using intermediary primers enabling a full-length coverage (all primers are listed in Table S5).
-
bioRxiv - Neuroscience 2019Quote: ... with ten-fold dilution of cDNA and 200 nM of each primer using the SYBR Select PCR Master Mix (ABI, Thermo Fisher). Primers are listed in Table S1 ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR was performed in 25 μL reaction volumes with gene-specific primers and conducted with a StepOne Plus Real-time PCR System (Applied Biosystems) using the SYBR Green qPCR Master Mix (Thermofisher) ...
-
bioRxiv - Plant Biology 2019Quote: ... full-length MIK2 was amplified from genomic DNA by PCR with gene-specific primers using Phusion Hot Start High-Fidelity DNA Polymerase (Thermo Scientific) and purified PCR products were sequenced using appropriate nested primers ...
-
bioRxiv - Microbiology 2019Quote: ... Semi-quantitative PCR was performed on 15 ng of corresponding cDNA with the primers described below and utilising the SYBR Green PCR Master Mix (Thermo Scientific). Relative mRNA abundance was quantified using the 2-ΔΔCT method (CT ...
-
bioRxiv - Pathology 2021Quote: ... cDNA was diluted to 1 ng/μl and mixed with 7.8 μM of primers and added in equal volume to 2X Power SYBR™ Green PCR Master Mix (Thermofisher #4367659). The primers used are described below;
-
bioRxiv - Evolutionary Biology 2020Quote: ... The cDNA was diluted 16-fold and 5 μl was subjected to real-time quantitative PCR using gene-specific primers (listed in Supplemental Table S9) and SYBR Green PCR master mix in an ABI-7000 sequence detection system (Applied Biosystems). The samples were measured by three repeats.
-
bioRxiv - Genomics 2021Quote: RNA in 2X SuperScript III buffer was incubated for 1 min at 50 °C on a PCR cycler with 2.5 μl of the following mix: 1.5 μg Random Primer (Life Technologies 48190-011), 10 μM Oligo d(T ...
-
bioRxiv - Immunology 2021Quote: ... qRT-PCR was carried out using predesigned PrimeTime qPCR Primers (IDT) and TaqMan Universal Master Mix II with UNG (Applied Biosystems), combined with cDNA samples in a 96-well PCR plate and run on a 7500 Fast Real–Time PCR system (Applied Biosystems) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Polymerase Chain Reaction (PCR) primers for inserting different LacO sites and pLac were purchased from Integrated DNA Technologies (IDT) and Life Technologies (Thermo Fisher). GFP was obtained from pAKgfp1 (Addgene #14076) ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative RT-PCR and primer sequences were previously described (Kolmos et al., 2009) with following modifications: ABsolute Blue qPCR SYBR Green (ThermoFisher®) was used instead of iQ SYBR Green (Biorad) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 µL of the amplified product was subjected to another PCR reaction using primer pair AK4340F2 and AK4630R2 (Kapoor et al., 2013) along with the DreamTaq DNA Polymerase (ThermoFisher Scientific). The PCR conditions comprised of 3 min of denaturation at 95 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were analysed in triplicate with SYBR GREEN dye (Primer Design Precision Master mix) on an ABI StepOnePlus quantitative PCR instrument (Applied Biosystems). The comparative Ct method was employed to measure amplification of specific mRNAs vs ...