Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for GA binding protein alpha chain GABPA Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibody dilutions were used: anti-folate receptor alpha 1 (1/300; Thermofisher, ref: PA5-101588) for nuclear fraction and anti-Sox2 (1/1000 ...
-
bioRxiv - Physiology 2022Quote: ... To isolate proteins, tissues were homogenized using a handheld homogenizer (Omni International, Kennesaw, GA, USA) in T-PER tissue extraction reagent (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by insertion into each site of TTHA0766 lactate binding protein (LBD) in a pBAD vector (Life Technologies) by Gibson assembly (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... and the lipid-binding proteins were detected using the SuperSignal West Femto Maximum Sensitivity Substrate kit (ThermoFisher Scientific) and a ChemiDoc MP imaging system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... Resin was then washed 3x with binding buffer and protein was eluted with 4X LDS sample buffer (ThermoFisher). Samples were run on a Bis-Tris gel and stained with Coomassie Brilliant Blue R-250 (GolBio).
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight in polyclonal anti-RBPMS (RNA Binding Protein Multiple Partners; 1:1000; ThermoFisher, CAT: PA5-31231) at 4ºC ...
-
bioRxiv - Biochemistry 2023Quote: ... Manufacturer B (Pierce™ Microcentrifuge Tubes no. 69715 and Low Protein Binding Microcentrifuge Tubes no. 90410, Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cell lystaes were then transferred to low-protein binding Eppendorf tubes (Cat. No. 13-698-794, Fisher Scientific) containing 3 μl of anti-REV-ERBα antibody ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1 mM MgCl2 containing 4.5 µM phosphate-binding protein labeled with a phosphate sensor (MDCC, Fisher Scientific) for intrinsic GTPase activity or containing 1 nM NF1-GAP for GAP mediated GTPase activity ...
-
bioRxiv - Neuroscience 2024Quote: GA-attL1-MECP2-522-F (tgtacaaaaaagcaggctccggcaccatggtagctgggatgttag) GA-attL1-MECP2-522-R (ttgtacaagaaagctgggtctatcagctaactctctcggtc) Amplicons were cloned in PCR8-GW-TOPO (Invitrogen, ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Antibody binding was revealed using a SuperSignalTM West Dura Extended Duration substrate system (Thermo Fisher Scientific) and a G ...
-
bioRxiv - Bioengineering 2023Quote: ... binding was quantified by measuring the fluorescence of a PE-conjugated anti-human Fc antibody (Invitrogen) detecting the Fc-fused protein target ...
-
bioRxiv - Immunology 2023Quote: ... After treating the cells for 15 minutes (min) with Fc Receptor Binding Inhibitor Polyclonal Antibody (ThermoFisher), they were stained for 30 min at 4°C in the dark and washed twice again ...
-
bioRxiv - Cell Biology 2023Quote: ... the antibody binding was visualized using either SuperSignal™ West Pico or Femto Substrate (Thermo Scientific). All information regarding the antibodies used is provided in the supplementary files.
-
bioRxiv - Cell Biology 2023Quote: ... Binding of the secondary HRP-coupled antibody was detected using a chemiluminescent substrate kit (Thermo Scientific) and recorded with an automated developer machine (Agfa) ...
-
bioRxiv - Immunology 2022Quote: ... to prevent non-specific antibody binding before staining with Zombie Aqua Fixable Viability Dye (Thermo Fisher) and anti-human CD45 antibody (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... Chemicals were purchased from Fisher Scientific (Atlanta, GA), VWR International (Pittsburg ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Gas permeable adhesive plate seals (Thermo Scientific™) ensured oxygen transfer ...
-
bioRxiv - Microbiology 2022Quote: A Trace-5 gas chromatograph from Thermo Fisher with a VF-WAXms column (60 m / 0.25 mm / 0.25 µ m ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Terfenadine was purchased from Fisher Scientific (Atlanta, GA). Buprenorphine HCl and norbuprenorphine were purchased as 1 mg/mL solutions in methanol ...
-
bioRxiv - Bioengineering 2023Quote: ... and 0.1% glutaraldehyde (GA) (Thermo Fisher Scientific, US) to allow for subsequent covalent binding of pH-adjusted rat tail collagen ...
-
bioRxiv - Microbiology 2024Quote: ... yeast extract (Fisher Scientific Global Solutions, Suwanee, GA), L-cystine (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... then incubated with 0.5% glutaraldehyde (GA; Fisher Scientific) for 45 minutes and rinsed with sterile water 3x before hydrogel injection to prevent delamination of the hydrogel from the PDMS due to cell-mediated contractile forces (15) ...
-
bioRxiv - Neuroscience 2020Quote: ... primary DP cells from P5-8 Tgfbr2fl/fl molars were grown in alpha-minimum essential medium (alpha-MEM; Gibco) supplemented with 10% heat-inactivated fetal bovine serum ...
-
bioRxiv - Genetics 2024Quote: ... The final digest was placed in a plastic cell culture dish with alpha modified Eagle’s medium (alpha-MEM) (Invitrogen) supplemented with 10% fetal bovine serum (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... fetal liver cells were thawed and cultured for 48 h in alpha-minimum essential media (alpha-MEM) Glutamax (Gibco) containing 10% FCS ...
-
bioRxiv - Genomics 2021Quote: ... using Lysis/Binding Buffer (Invitrogen), and frozen at −80◦ ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Annexin-binding Buffer (Invitrogen) according to the manufacturer’s specifications ...
-
bioRxiv - Bioengineering 2020Quote: ... (primary Rabbit anti-mouse alpha-SMA antibody; Cat. No. ab5694; Abcam; 1:50 dilution; secondary Goat anti-rabbit antibody; Cat. No. A11008; Life Technologies; 1:150 dilution). Fluorescent images were acquired using a Leica SP8 confocal microscope ...
-
bioRxiv - Genomics 2021Quote: ... The membranes were incubated overnight with UCP1 antibody and loading control protein alpha tubulin antibody for the total protein adipose tissue samples (1:1.000 UCP1 Polyclonal Antibody, cat no. PA1-24894, 1:500 alpha Tubulin Polyclonal Antibody, cat no. PA5-16891, Invitrogen, Thermo Fisher Scientific, Rockford, USA). Membranes with liver and muscle mitochondrial protein samples were incubated overnight with COX4 antibody (1:1.000 COX4 Polyclonal Antibody ...
-
bioRxiv - Biophysics 2023Quote: ... Total tubulin was labeled using a primary antibody against alpha-tubulin and a Cy3-tagged secondary antibody (Thermo Fisher Scientific Inc., Waltham, MA, USA).
-
bioRxiv - Immunology 2022Quote: Fab generation was initiated with plasmids encoding the truncated heavy chain and light chain of LY-CoV1404 (1 ug/mL each) that were co-transformed into expi293 cells (expifectamine, Gibco) for protein expression (5 days) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 5-μm frozen sections of uterine myometrium embedded in OCT compound were obtained using Leica CM1510 S cryostat and immunostained for phosphorylated myosin light chain kinase (1:200 rabbit anti-mouse phosphomyosin light chain kinase, Invitrogen) and imaged with the Zeiss Axioskop 40 microscope ...
-
bioRxiv - Biochemistry 2022Quote: ... were transfected with the appropriate light chain and heavy chain encoding plasmids for each Fab following the ExpiFectamine CHO Transfection Kit (ThermoFisher) high titer protocol ...
-
bioRxiv - Biophysics 2022Quote: ... were transfected with the appropriate light chain and heavy chain encoding plasmids for each Fab following the ExpiFectamine CHO Transfection Kit (ThermoFisher) high titer protocol ...
-
bioRxiv - Microbiology 2022Quote: ExpiCHO cells were transfected with equimolar amounts of pLM-M28 light chain and pLM-M28 heavy chain expressing plasmids according to the manufacturer’s protocol (Thermo Fisher). At 12 days post-transfection ...
-
bioRxiv - Bioengineering 2024Quote: ... c-myc epitope tag and the variable heavy chain from mAbCII linked to the variable light mAbCII chain was procured from GeneArt (ThermoFisher). This fragment was cloned into a lentiviral expression plasmid we have previously described (31 ...
-
bioRxiv - Molecular Biology 2024Quote: ... For the light-induced expression of the different bsAb chains, the single chain DNA sequences (LC, HC, and HCscFv) were synthesized by GeneArt (ThermoFisher) and inserted into the pcDNA3.1_5xC120-minP vector ordered at Genscript ...
-
bioRxiv - Biochemistry 2024Quote: ... were cultured and transfected with plasmids for heavy chain and light chain expression with or without co-expression of S1S3 PTase plasmid following the manufacturer’s protocol (ThermoFisher, A29131). Cells were cultured for 7-8 days ...
-
bioRxiv - Plant Biology 2021Quote: ... Antibody-coated Protein A Dynabeads (Invitrogen) were incubated 12 hours at 4 °C with the samples ...
-
bioRxiv - Plant Biology 2023Quote: ... Antibody-coated Protein A Dynabeads (Invitrogen) were incubated 12 h at 4°C with the samples ...
-
bioRxiv - Immunology 2024Quote: ... antibody and protein-G-Dynabeads (Invitrogen) were incubated overnight at 4° C ...
-
bioRxiv - Cell Biology 2020Quote: ... Clathrin Heavy chain (clone X22, ThermoFisher MA1-065), Lamin B (clone L-5 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-mouse-Clathrin light chain (Invitrogen, 1:2000), anti-mouse-Dynamin2 (Santa Cruz) ...
-
bioRxiv - Immunology 2024Quote: ... the blots were probed for the presence of heavy and light chain bands using either horseradish peroxidase (HRP)-conjugated polyclonal goat anti-human IgG Fc antibody or polyclonal goat anti-human kappa chain antibody (Thermo Fisher Scientific, Waltham, MA, USA). Antibody-coupled HRP activity was detected with Supersignal West Dura Extended Duration Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... and allowed to incubate with a combination of Alexa Fluor 488-labeled anti-alpha smooth muscle actin antibody (Invitrogen/Thermo product # ...
-
bioRxiv - Microbiology 2021Quote: ... Pierce™ white streptavidin-coated high binding capacity 96-well binding plates (ThermoFisher Scientific; 15502) were washed twice with ELISA wash buffer and coated with 5μg/ml of biotiylated peptides at room temp ...
-
bioRxiv - Genetics 2021Quote: The sequence of the Vd_octβ2r gene described in this study was used to design primers (flanking the N87 and Y215 positions in the Vd_Octβ2R protein) and two minor groove-binding probes (MGB) (ThermoFisher Scientific) using the Custom TaqMan® Assay Design Tool (https://www.thermofisher.com/order/custom-genomic-products/tools/genotyping/) ...
-
bioRxiv - Immunology 2021Quote: ... 18,000xg) and pre-cleared for non-specific binding with 40 ul BSA-blocked protein A/G magnetic Dynabeads (Invitrogen) for 4h at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... The recombinant proteins were affinity purified by overnight binding to HisPur Cobalt Resin (Thermo Fisher Scientific, U. S. A.) in buffer A (50 mM Tris-HCl (pH 7.6) ...