Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for CKLF Like MARVEL Transmembrane Domain Containing 7 CMTM7 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... biotinylated with 7:1 biotin-to-antibody using EZ-Link Sulfo-NHS-LC-Biotinylation Kit (21435, Thermo Fisher Scientific), was prepared in dilution buffer ...
-
bioRxiv - Immunology 2022Quote: ... Supernatant was collected for 7 days and the antibody was purified using a protein A column (ThermoFisher scientific, # 89960). Ligand binding affinity and sensitivity were assessed using ELISA techniques.
-
bioRxiv - Cell Biology 2022Quote: ... Blocking buffer was replaced after one hour with 7 µg/mL mouse anti-occludin antibody (cat# 33-1500, Invitrogen) in PBS with 5% goat serum ...
-
bioRxiv - Immunology 2020Quote: ... Anti-mouse monoclonal antibodies targeting cell surface antigens included anti-GL7 (FITC, PE, eFluor660; clone GL 7; Thermo Fisher), anti-B220 (PE-Cy7 ...
-
bioRxiv - Immunology 2021Quote: ... Supernatant was collected for 7 days and the antibody was purified using a protein A column (ThermoFisher scientific, # 89960). Ligand binding affinity and sensitivity were assessed using ELISA techniques.
-
bioRxiv - Biophysics 2020Quote: The plasmid pT7-7 containing human aSyn cDNA was transformed into Escherichia coli One Shot® BL21 (DE3) Star™ (Thermo Fisher Scientific, USA). 0.5 L cultures of E ...
-
bioRxiv - Molecular Biology 2021Quote: ... in QuantStudio 7 Flex (Applied Biosystems), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 μL of RNaseI (Invitrogen AM2249) was added to the clarified lysates and digestion was done for 1 h at 4 °C ...
-
bioRxiv - Immunology 2021Quote: ... on QuantStudio 7 Flex (Applied Biosystems). For quantification of gene expression ...
-
bioRxiv - Bioengineering 2019Quote: ... 7′-dichlorodihydrofluorescein diacetate (cm-H2DCFDA, Invitrogen) for 60 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... or QuantStudio 7 Flex (Applied Biosystems). Refer to Supplemental Table 5 for primer sequences used.
-
bioRxiv - Cell Biology 2020Quote: ... or QuantStudio 7 Flex (Applied Biosystems). All mRNA expression levels were calculated relative to the housekeeping gene ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 7% KnockOut SR (vol/vol) (Gibco), 2 mM L-glutamine ...
-
bioRxiv - Developmental Biology 2020Quote: ... 7% KnockOut SR (vol/vol) (Gibco), 2mM L-glutamine ...
-
bioRxiv - Immunology 2021Quote: ... with 7% heat-inactivated FBS (Invitrogen) and 1X penicillin-streptomycin (Invitrogen).
-
bioRxiv - Cell Biology 2021Quote: ... program #3 for 7 min (ThermoFisher). The membrane was saturated by incubation in PBS (without EDTA ...
-
bioRxiv - Immunology 2019Quote: ... or 7-AAD (Thermo Fisher Scientific) were used to exclude dead cells.
-
bioRxiv - Cell Biology 2019Quote: ... or Quantstudio 7 flex (Life Technologies). The PCR mix was annealed/extended at 60 °C for 60 seconds ...
-
bioRxiv - Cell Biology 2020Quote: ... 7-AAD (Thermo Fisher Scientific, A1310) or propidium iodide (Sigma-Aldrich ...
-
bioRxiv - Physiology 2021Quote: ... using ViiA 7 Software (Applied Biosystems).
-
Hepatic FGF21 mediates tissue tolerance during bacterial inflammation by preserving cardiac functionbioRxiv - Immunology 2020Quote: ... or QuantStudio 7 Flex (Applied Biosystems) using PerfeCTa SYBR Green SuperMix (Quanta Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... 7-AAD (Invitrogen, 00-6993-50) were added ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2′,7′-dichlorofluorescein (DCF) (Invitrogen, C6827) was used to determine intracellular ROS levels ...
-
bioRxiv - Immunology 2022Quote: ... 7-AAD (Invitrogen, 00-6993-50) was used to label dead cells ...
-
bioRxiv - Developmental Biology 2022Quote: ... or the QuantStudio 7 (Applied Biosystems) with the software version 1.3 (ThermoFischer Scientific) ...
-
bioRxiv - Physiology 2022Quote: ... and 7-AAD (Invitrogen, Waltham, MA) were added to exclude hematopoietic lineage cells and dead cells ...
-
bioRxiv - Immunology 2023Quote: ... or 7-AAD (Thermo Fisher Scientific). Flow cytometry was performed using a BD Fortessa instrument (BD Biosciences) ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 7-AAD (Life Technologies) (2 µg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... ViiA 7 RUO software (Applied Biosystems) was used to calculate the amount of RNA relative to wild type animals for the equivalent time points ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 kDa (Thermo Fisher Scientific, 66370) overnight at 4°C against three changes of 1 L refolding buffer (2 M NaCl ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 7% FBS (16140071, Gibco) and 10 mg/L ampicillin (171254 ...
-
bioRxiv - Immunology 2024Quote: ... or 7-AAD (Thermo Fisher Scientific) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... HT-7 (Thermo Scientific™, # MN1000), Tau pS202/T205 (AT8 ...
-
bioRxiv - Physiology 2020Quote: Caspase-3-like activity was quantified using the EnzChek Caspase-3 Assay kit #1 (Molecular Probes, Eugene, OR, USA). Tissue samples were thawed on ice for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... A549 (male, human lung epithelial-like) cells were obtained from ATCC and grown at 37 °C in DMEM (Gibco) supplemented with 10 % FBS (GE Healthcare Life Science ...
-
bioRxiv - Cell Biology 2022Quote: ... ES03 cells were grown on MEF feeders in KSR+bFGF and passaged enzymatically using trypsin-like enzyme (TrypLE, Invitrogen) for at least 3 passages before electroporation ...
-
bioRxiv - Microbiology 2019Quote: ... The MamK-like gene from strain Poly30T was amplified by standard PCR procedures with Phusion DNA polymerase (Thermo Scientific) using the primers RPA821_NheI (CTAGCTAGCATGACCGACATC ACGACCGAC ...
-
bioRxiv - Microbiology 2021Quote: Green monkey kidney fibroblast-like Cos7 cells were cultured at 37 °C with 5% atmospheric CO2 in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... BMEC-like cells in well plates were treated with 10 μM cyclosporin A (CsA; Fisher Scientific #11-011-00), a p-glycoprotein inhibitor ...
-
bioRxiv - Genomics 2021Quote: ... SH-SY5Y neuroblast-like cells were maintained in Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F-12) (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Cell Biology 2022Quote: ... They were passaged twice weekly by rinsing in phosphate buffered saline and dissociation in Trypsin like-enzyme (ThermoFisher 12604039) before diluting 1:5 into fresh media ...
-
bioRxiv - Immunology 2022Quote: RAW 264.7 murine macrophage-like cells (TIB-71; ATCC) and their derivatives were cultured in RPMI 1640 media (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... They were passaged twice weekly by rinsing in phosphate buffered saline and dissociation in Trypsin like-enzyme (ThermoFisher 12604039) before diluting 1:5 into fresh media ...
-
bioRxiv - Molecular Biology 2022Quote: ... and subsequently incubated with secondary antibodies in blocking solution containing DAPI (Thermo Scientific) [1:1000 anti-Rabbit Alexa 488 (Life Technologies) ...
-
bioRxiv - Immunology 2020Quote: ... an antibody cocktail containing LIVE/DEAD Fixable Dead Cell Stain Kit (Thermo Fisher), and the surface antibodies listed in S1 Table were added for 30 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Membranes were blocked in 4% skimmed milk powder dissolved in 0.2% Tween-containing 1X PBS and incubated with primary antibodies followed by secondary antibodies (Invitrogen). Primary antibodies used were LC3 (5F10 ...
-
bioRxiv - Neuroscience 2020Quote: ... After washing with PBT the slices were incubated for 24 h at 4 °C in PBT containing 0.001 % secondary antibodies (see Antibody list) and 0.002 % streptavidin conjugated to Cy5 fluorophore (ThermoFisher Scientific). The slices were washed in PB for 3 h and thereafter incubated in CUBIC reagent 2 (50 wt% sucrose ...
-
bioRxiv - Cell Biology 2022Quote: ... antibodies in PBS containing 1% BSA for 1 h and then with Alexa Fluor secondary antibodies (1:1000, Invitrogen) and Hoechst 33258 (1:2000 ...
-
bioRxiv - Cell Biology 2019Quote: ... or caspases 3/7 (Caspase-3/7 Green ReadyProbes™ reagent with a DEVD sequence, Molecular Probes).
-
bioRxiv - Cell Biology 2019Quote: ... or caspases 3/7 (Caspase-3/7 Green ReadyProbes™ reagent with a DEVD sequence, Molecular Probes).