Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... 0.5-1.0 mg of cell lysate was incubated with 2-4 µg of antibody for 1 h followed by incubation with 8-10 µl of Protein G agarose (Thermo Fisher) for another 30-45 min ...
-
bioRxiv - Systems Biology 2023Quote: ... A 1 mL aliquot of 2:2:1 (v/v) mixture of ≥ 99.9% purity acetonitrile (Fisher Scientific; Cat.A998-4) ≥ 99.8% purity methanol (Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclear stain: 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI, blue; 2 ng ml−1; Molecular Probes, USA). Sections were cover-slipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: RNF168 si #1: 5’- GGCGAAGAGCGAUGGAGGATT-3’ (Ambion)
-
bioRxiv - Cell Biology 2021Quote: ... cells were loaded with 3 μM Fura-2-AM and 0.01% (v/v) Pluronic F-129 (both from Molecular Probes) in DMEM medium at 37 °C for 20 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... The isolated cells were expanded in tissue culture flasks for 2-3 days in proliferation medium containing DMEM/F-12 media (Gibco), penicillin-streptomycin (Gibco) ...
-
bioRxiv - Microbiology 2023Quote: ... and counterstained with 4′,6-diamidin-2-phenylindole (DAPI, 4 μg mL-1, Thermo Fisher Scientific, MA, USA). From the 18 biofilms from each year ...
-
bioRxiv - Neuroscience 2024Quote: ... 2% Pluronic F-127 (ThermoFisher) for 1 hour prior to imaging ...
-
bioRxiv - Immunology 2022Quote: Caspase-3 activity was determined using EnzChek™ Caspase-3 Assay Kit #2 (Thermo Fisher).
-
bioRxiv - Microbiology 2021Quote: ... (75 mm i.d. 3 2 cm, Acclaim PepMap100 C18 3 mm, 100 A°, ThermoFisher Scientific) and separated over an EASY-Spray column ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2-deoxy-2-[(7-nitro-2,1,3-benzoxadiazol-4-yl)amino]- D-glucose (2-NBDG) (Invitrogen N13195) was used as a probe for monitoring glucose uptake ...
-
bioRxiv - Developmental Biology 2021Quote: ... Media was changed daily and the cells passaged every 3–4 days at a ratio of 1:4 using the StemPro EZPassage tool (ThermoFisher Scientific).
-
bioRxiv - Neuroscience 2021Quote: ... Samples were incubated at 4°C for 3 hours on a rotator before being placed in a DynaMag™-2 magnetic rack (Thermo Scientific, 12321D) and washed twice with TBS+NP40 wash buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... Fluorescence-labelled 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (NBD-PE) was obtained from Molecular Probes (Eugene, Oregon, US). Sucrose was purchased from XiLong Chemical Co. ...
-
bioRxiv - Immunology 2019Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher).
-
bioRxiv - Neuroscience 2019Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Life Technologies) staining was added to visualize nuclei.
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6- diamidino-2-phenylindole (DAPI; Invitrogen D1306) was added during the secondary antibody incubation at a concentration of 700 ng/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2-4 μg/ml of Blastidin (ThermoFisher Scientific) and 100-400 μg/ml of G418 (ThermoFisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... 4’,6-Diamidino-2-phenylindole (DAPI, D21490, ThermoFisher) stain was done for 15 min at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... and 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen). Confocal analyses of stained slides were performed using a TCS SP8 Laser Scanning Spectral Confocal Microscope (LEICA Microsystems) ...
-
bioRxiv - Molecular Biology 2019Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher) and ActinRed™ 555 ReadyProbes™ (Molecular Probes ...
-
bioRxiv - Immunology 2020Quote: ... Puromycin (2-4 μg/ml, Thermo Fisher, A113803) was used for TRIM25-knockdown HEK293T cell selection ...
-
bioRxiv - Neuroscience 2022Quote: DAPI (4′,6-diamidino-2-phenylindole, D1306, Invitrogen) staining was performed by incubation at 1:500 for 10 min in DPBS ...
-
bioRxiv - Neuroscience 2022Quote: ... DAPI (4’, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was applied to samples at a concentration of 0.1μg/ml ...
-
bioRxiv - Bioengineering 2022Quote: ... DAPI (4’ −6’ -diamino-2-phenylindole, dilactate; Invitrogen) was used for nuclear staining ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher) was added for 30 min at room temperature before the secondary antibodies were washed out in PBS 3x for 15 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, D3571) was added for 5 minutes in the dark ...
-
bioRxiv - Cancer Biology 2023Quote: ... DAPI (4-6-diamindino-2-phenylindole; Molecular Probes) was used to detect DNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... (N-((6-(2,4-DNP)Amino)Hexanoyl)-1-(BODIPY® F C5)-2-Hexyl-Sn-Glycero-3-Phosphoethanolamine) was purchased from Molecular Probes (Melbourne, VIC, Australia). The TiO2 was collected from a disassembled column ...
-
bioRxiv - Bioengineering 2020Quote: ... 3) latrunculin-b (Lat-B; 2 μM; Fisher Scientific), 4 ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM 2-deoxy-D-glucose (2DG; ACROS Organics), 2 μM PERK inhibitor (PERKi ...
-
bioRxiv - Plant Biology 2022Quote: ... 2–3 μg were treated with Turbo DNase (Ambion). RNA was circularized using T4 RNA ligase and reverse transcription was performed with the Superscript III (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... glass (2 gm, 3 mm bead diameter; Fisher Scientific) and polystyrene (24-well plates ...
-
bioRxiv - Cell Biology 2019Quote: The staining of limiting membrane of the yeast vacuole was achieved with FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Invitrogen). Cells were grown to early-log phase in appropriate medium ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell extracts (20 µg/lane) were fractionated in 3%-8% or 4-12 % tris-acetate gel (NP0006, NuPAGE Life Technologies). All antibodies were used at the concentrations recommended by the manufacturers.
-
bioRxiv - Cell Biology 2020Quote: ... IP and lysate samples were separated by SDS-PAGE on precast 3-8% tris-acetate and 4-12% bis-tris acrylamide gels (Invitrogen) followed by transfer to 0.2 μm nitrocellulose membranes (Amersham) ...
-
bioRxiv - Genetics 2020Quote: ... Samples were loaded on 4-12% NuPAGE Bis-Tris gels or 3-8% NuPAGE Tris acetate gels (Thermo Fisher Scientific) and transferred to the nitrocellulose membranes (GE Healthcare ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were resolved on NuPage 3-8% w/v Tris-Acetate or 4-12% w/v Bis-Tris gels (Invitrogen) and transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2021Quote: Extracts were analyzed by SDS–PAGE using a 4-12% Bis–Tris or 3-8% Tris-Acetate NuPAGE gels (Invitrogen) and transferred onto PVDF membranes (Millipore) ...
-
bioRxiv - Neuroscience 2020Quote: ... Homogenates were submitted to an SDS-PAGE protein separation in 4-12 % or 3-8 % (depending on the molecular weight of the protein of interest) NuPAGE bis-tris gels (Invitrogen) and transferred to a nitrocellulose membrane (Amersham) ...
-
bioRxiv - Cell Biology 2021Quote: ... and equal concentrations of each sample were separated on a 3-8% Tris-Acetate or 4-12% Bis-Tris gel (Invitrogen) by SDS-PAGE and transferred to a nitrocellulose membrane ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins were separated in 4-12% Nu-Page Bis-Tris (FANCA analysis) or NuPAGE 3-8% Tris-Acetate (FANCD2) polyacrylamide gels (Invitrogen) and transferred to nitrocellulose membranes (Amersham Biotech ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein lysates were run at 200V for an hour through either a 4-12% Bis-Tris or 3-8% Tris Acetate gel (Invitrogen), and then transferred at 300 mA for one hour in 15% methanol 1x Transfer Buffer on a methanol activated PVDF membrane ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μg of total cellular proteins fractionated through 3-8% polyacrylamide Tris-acetate or 4-12% polyacrylamide Bis-Tris gels (Invitrogen) were subsequently transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of total cell lysates were loaded to 4–12% Bis-Tris or 3–8% Tris-Acetate gels (Invitrogen) and transferred to 0.2 µm PVDF membranes via wet tank or semi-dry method (specified in the supplementary information) ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were resolved on NuPAGE 3-8% (wt/vol) Tris-acetate or 4-12% (wt/vol) Bis-Tris gels (Invitrogen) and transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were stained with 4’,6diamidino-2-phenylindole (DAPI, 1:300, Invitrogen) at 37 °C for 5 min in PBTX solution ...
-
bioRxiv - Microbiology 2019Quote: ... and 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Thermo Fisher), referred to as complete DMEM (cDMEM) ...
-
bioRxiv - Neuroscience 2021Quote: ... at 1:200 and (4’,6-diamidino-2-phenylindole) DAPI (Fisher Scientific) at 1:10,000.