Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... blotted for 3–4 s in a Vitrobot Mark IV (Thermo Fisher) at 15 °C and 100% humidity ...
-
bioRxiv - Microbiology 2020Quote: ... PobA activity was inhibited with methyl 4-hydroxy-3-iodobenzoate (Fisher Scientific) at a saturating concentration (0.48 mM) ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons were grown for 3-4 days in Neurobasal medium (Thermo Fisher) supplemented with 2% FBS (HyClone) ...
-
bioRxiv - Microbiology 2020Quote: ... at 4 °C for 3 h on a Labquake rotator (ThermoFisher Scientific). The beads were washed with 1 mL cold lysis/binding buffer four times at 300 g for 4 min at 4 °C ...
-
bioRxiv - Biophysics 2021Quote: ... Stained cells were cytospun (Thermo Scientific Cytospin 4 1000rpm for 3 minutes) onto 1.5 thickness coverslips and mounted with ProLongTM Gold mounting medium (Molecular Probes #P36934 ...
-
bioRxiv - Molecular Biology 2022Quote: ... iPSC-neurons were incubated with 3 µM Fluo-4 (Life Technologies #F14201) at 37°C for 20 min and imaged directly following washout on an LSM Zeiss 880 inverted confocal microscope using a 63×oil 1.4 numerical aperture objective and a 488-nm argon ion laser ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were passaged every 3 to 4 days using Accutase™ (Gibco) for up to 10 passages.
-
bioRxiv - Neuroscience 2024Quote: ... Invitrogen) and DiD (1,1’- Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate Salt; Invitrogen) crystals were inserted under a stereo fluorescence microscope (MZ10 F ...
-
bioRxiv - Genetics 2023Quote: ... Cultures were passaged enzymatically every 3-4 days using 0.25% Trypsin (Gibco) diluted 1:3 in 1X PBS (Gibco) ...
-
bioRxiv - Immunology 2021Quote: ... was added as the secondary antibody at a 1:2000 dilution for 1 h at 37C, followed by adding TMB (3, 3, 5, 5’-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) for about 15 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... at 4°C for 1-3 days followed by secondary antibody (1:500, Thermo Fisher Scientific #A-21206) overnight at 4°C.
-
bioRxiv - Cell Biology 2020Quote: ... Equal masses of lysates were separated by SDS-PAGE using either 4-12% Bis Tris gels or 3-8% Tris acetate gels (Thermo Fisher Scientific). All IRS2 immunoblots were separated on 3-8% Tris acetate gels with the exception of those shown in Figures 5A and S4B ...
-
bioRxiv - Biochemistry 2021Quote: ... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3×(CAC)2 and (CAC)2 RNAs were transcribed using T7 RNA polymerase (Thermofisher Scientific). A 10 μl binding reaction contains 10 nM RNA ...
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Cancer Biology 2021Quote: Glucose uptake experiments were performed using 2-NBDG (2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose) (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Glucose was traced using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, ThermoFisher, cat. #N13195) combined with 0,57 mg/mL 40kDa tetramethyl-rhodamine Dextran (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Biophysics 2022Quote: ... and 2-3 μL of the freshly phase-separated sample was placed into a chamber made on a glass slide (Fisher Scientific 3” × 1” × 1 mm). The chamber made by using double-sided tape was then sealed with a square coverslip to avoid evaporation of the sample ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cell Biology 2021Quote: ... and 2-NDBG [2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose] (N13195) were purchased from Invitrogen. Recombinant murine SCF (250-03) ...
-
bioRxiv - Bioengineering 2023Quote: ... All samples were then incubated with 4′,6-Diamidino-2-phenylindole (DAPI, 2 µM, Thermofisher) as a nuclear counterstain and Alexafluor 555 phalloidin (1:60 ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were lysed by adding 1:4 SDS buffer (2% SDS, EDTA) and samples were sonicated (5×1s pulses, 80% power, Fisher Scientific). Samples were diluted to 0.2% SDS with TX-100 lysis buffer and centrifuged for 20 min at 20,000 x g ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were lysed by adding 1:4 SDS buffer (2% SDS, EDTA) and samples were sonicated (5×1s pulses, 80% power, Fisher Scientific). Samples were diluted to 0.2% SDS with TX-100 lysis buffer and centrifuged for 20 min at 20,000 x g ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were washed 3x with 1x PBS (5 minutes per wash) prior to 4’,6-diamidino-2-phenylindole (DAPI; 1:3000; Thermo Fisher) incubation for 5 minutes at room temperature to stain nuclei ...
-
bioRxiv - Cancer Biology 2023Quote: ... The lungs were inflated with 1-3 ml 2% UltraPure Low Melting Point Agarose (Invitrogen). Lungs and livers were fixed overnight at 4°C on a shaker ...
-
bioRxiv - Biophysics 2021Quote: ... The filtered lysate was diluted 1:2 in purification buffer UA (8 M Urea, 50 mM sodium acetate [Acros Organics, Carlsbad, CA], pH 4). The protein was then purified using a cation exchange HiPrep SP HP 16/10 (Cytiva ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the fluorescent dye 4’,6-diamidino-2-phenylindole (DAPI; 1:1,000, Molecular Probes), respectively.
-
bioRxiv - Developmental Biology 2020Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI: nuclear counterstain; 1:1000; ThermoFisher, Waltham, MA).
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Invitrogen, 1:1000) for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole) (1:106, 62248, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... and for nuclei with DAPI (4’,6-Diamidino-2-Phenylindole Dihydrochloride; Invitrogen; 1:500). The antigen-antibody complex was visualized using the secondary antibodies dk anti-ms Rhodamine (1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... along with 1 µg/mL 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen; cat#: 62248) to stain the nuclei and Alexa Fluor 647 phalloidin at 1:100 (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were stained with 1:10,000 DAPI (4’,6-diamino-2-fenilindol, Molecular Probes), mounted with Prolong Diamond Antifade Mountant (Molecular Probes ...
-
bioRxiv - Bioengineering 2021Quote: FBS free culture media with 15mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (Gibco) in DMEM/F12 supplemented with 1% P/S was used for all experiments performed in the lung on a chip devices ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI 1:20000, Fisher Scientific) for 5 minutes before being washed ...
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Invitrogen, 1:2000) for 10 min and washed with PBS three times before mounting onto slides ...
-
bioRxiv - Cancer Biology 2022Quote: ... Molecular Probes DAPI (4’,6 Diamidino 2 Phenylindole, Dihydrochloride) (1:500, Thermo Scientific, D1306).
-
bioRxiv - Neuroscience 2020Quote: ... sections were counterstained with 4′,6-diamidino-2-phenylindole solution (DAPI, 1:10000, Invitrogen) before being washed in PB 0.05 M and mounted on slides using chromium (3 ...
-
bioRxiv - Neuroscience 2021Quote: ... buffered with 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 1M (ThermoFisher, ref. 15630106) and coated with 20 μg/mL laminin (Sigma Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... 1-2 x 107 cells were incubated in 4 µM PBS-diluted CFSE (Invitrogen) for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... and 15 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco, Gaithersburg, MD, USA). Cells were maintained at 37 °C in a humidified incubator with 5% CO2.
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; 1:1,000; D1306, Invitrogen). Sections were mounted with ProLong™ Gold Antifade Mountant (P36934 ...
-
bioRxiv - Microbiology 2023Quote: ... DNA were stained with 1 µg/ml 4′′,6-diamidino-2-phenylindole (DAPI, Invitrogen) for 15 min at RT ...
-
bioRxiv - Microbiology 2023Quote: ... cells were stained with 1:1000 DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, Invitrogen) for 10 minutes ...