Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... HSS117872 (Epsin-2) and HSS147867 (Epsin-3) (Invitrogen) on day 2 and 3 (Boucrot et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Passaged every 2-3 days with TrypleE (Gibco).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge, Thermo Fisher Scientific, Darmstadt, Germany). The fluorescence intensity of the supernatant was measured measured (485 nm excitation ...
-
bioRxiv - Biochemistry 2020Quote: ... The fluorogenic probe 7-diethylamino-3-(4’-maleimidylphenyl)-4-methylcoumarin (abbr. CPM, ThermoFisher, Cat# D346) in 100% DMSO was then added to both quench the enzymatic reaction and react with CoASH to yield the fluorescent CPM-SCoA complex for fluorescence quantification 27 ...
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Immunology 2020Quote: ... 25 mM 4-(2-hydroxyethyl)-1-piperazineeethanesulfonci acid (HEPES; Thermo Fisher), and 1X non-essential amino acids (Gibco ...
-
bioRxiv - Pathology 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies, 1:250) to reveal actin and the nucleus ...
-
bioRxiv - Physiology 2020Quote: ... and subsequently 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:50000) for 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:50000 dilution, Molecular Probes) was treated in the cells for 3min ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, #D1306, 1/1000) were incubated overnight at 4°C in the dark ...
-
bioRxiv - Genomics 2023Quote: ... 1X 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES) (Thermo Fisher Scientific), 1X MEM non- essential amino acids (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... 4’,6’-diamino-2-fenil-indol (DAPI) (1:25000, Life Technologies) and Phalloidin (Alexa 488 ...
-
bioRxiv - Genetics 2020Quote: ... Cells were passaged 1:2-1:6 every 2-4 days by being rinsed once with DPBS (Gibco) and dissociated using 0.5 mM EDTA (75 µl/cm2 ...
-
bioRxiv - Bioengineering 2022Quote: ... Nuclei and F-actin were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI, 300 nM, D1306, ThermoFisher) and phalloidin-AlexaFluor 647 (1:100 ...
-
bioRxiv - Microbiology 2019Quote: ... and 2 μl of 1 μM ToPro 3 (Molecular Probes T-3605), a nucleic acid dye that only permeates cell membranes of dead cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-phospho-Pak1-2-3 (pSer141) (44-940G, 1:2000) from Invitrogen/Thermo Fisher Scientific (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... phospho-PAK1/2/3 (Thr402) (ThermoFisher PA1-4636, 1:1000 for WB), phospho-PAK4 (Ser474)/PAK5 (Ser602)/PAK6 (Ser560 ...
-
bioRxiv - Cancer Biology 2023Quote: Mouse primary myoblasts were isolated from limb muscles of pups (2-3 days old) and cultured in Ham’s F-10 nutrient mixture (Invitrogen) with 20% FBS (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Mouse primary myoblasts were isolated from the limb muscles of 2-3 day-old pups and cultured in Ham’s F-10 nutrient mixture (Invitrogen) as described before.38 The culture medium was supplemented with 20% fetal bovine serum (FBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... Human naive PSCs were passaged as single cells every 4 days at split ratio 1:3 or 1:4 following dissociation with TrypLE (Gibco 12563-029) for 10 minutes (min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Human naive PSCs were passaged as single cells every 4 days at split ratio 1:3 or 1:4 following dissociation with TrypLE (Gibco 12563-029) for 10 minutes at room temperature (RT) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were washed 3 times in PBST and mounted in 4′,6-diamidino-2-phenylindole (DAPI)-containing ProLong Anti-fade Diamond mountant (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2020Quote: ... The samples were washed again in PBS for 3×15 min and mounted in DAPI (4-,6-diamidino-2-phenylindole; Life Technologies, D1306) for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... were separated using NuPAGE Bis-Tris gels (4 – 12 %) with 3-(N-morpholino)propanesulfonic acid (MOPS) or 2-(N-morpholino)ethanesulfonic acid (MES) running buffer (Thermo Fisher Scientific) followed by transferring to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2022Quote: N2A cells were transfected as described above with BicD2-KIF tail fusions and MBNL-GFP proteins at a ratio of 2:3 in 4-well chamber slides (Thermo Fisher, 154526). 24 hours after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... 4 µl of peptide mixtures were loaded onto an Acclaim PepMap precolumn (75 µm × 2 cm, 3 µm, 100 Å; Thermo Scientific) equilibrated in solvent A and separated at a constant flow rate of 250 nl/min on a PepMap RSLC C18 Easy-Spray column (75 µm × 50 cm ...
-
bioRxiv - Biochemistry 2023Quote: ... SDS-PAGE was carried out on either NuPAGE 4-12% Bis-Tris or 3-8% Tris-Acetate gels (Invitrogen). Western blotting analysis was carried out according to standard protocols with the antibodies listed in Table S5.
-
bioRxiv - Physiology 2023Quote: After loading with Fura-2 AM (5 μM, Invitrogen, F-1201), isolated sweat glands on coverslips were mounted in an open chamber and rinsed with standard bath solution containing (in mM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... stained with N-(3-triethylammonium propyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM 1-43FX, Invitrogen, Cat.-No. F35355) at 5.6 µg ml-1 ...
-
bioRxiv - Microbiology 2024Quote: ... at physiological pH before being spun down and resuspended in PBS with the addition of FM 1-43 Dye (N-(3-Triethylammoniumpropyl)-4-(4-(Dibutylamino) Styryl) Pyridinium Dibromide (Cat. no. T3163, Invitrogen). Images were taken on a Zeiss X10 light microscope and cell area was measured using CellProfiler 4.2.1 (33,34).
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 5 µg / µl 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) and slides were mounted with FluoromountG (SouthernBiotech).
-
bioRxiv - Microbiology 2019Quote: ... Primer 2: 5’-GGATGTTCGTCCAGTGAGATTAG-3’) using a 7500 Fast Real-Time PCR System (Applied Biosystems) and accompanying software to analyze qPCR data.
-
bioRxiv - Neuroscience 2022Quote: ... dissociated with Accutase for 3-4 minutes (Fisher Scientific #A1110501), collected via centrifugation ...
-
bioRxiv - Microbiology 2023Quote: ... 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine 4-chlorobenzenesulfonate salt (DiD; Invitrogen). IAV sizes were determined (Figure S4 ...
-
bioRxiv - Cell Biology 2022Quote: ... or 4 µM TO-PRO-3 Iodide (TOPRO, Thermo Scientific). Acrosomes were visualized using 0.5 µg ml-1 lectin peanut agglutinin (PNA) ...
-
bioRxiv - Cell Biology 2019Quote: ... FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) was purchased from Invitrogen. Rapamycin was purchased from LC Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Bioengineering 2024Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, Cat # N13195) and incubated for 30 minutes in their respective culture conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... Secondary antibody (2-3% serum, 0.4% PBST, 1:500 Invitrogen A11035, 1:500 DAPI) was applied and incubated for one hour at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 mM of 4-(2-hydroxyethyl)-1-piperazine-1-ethanesulfonic acid (HEPES) (Gibco) and 1 ng/mL of human bFGF (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2022Quote: ... 1:2000) and 4′,6-diamidino-2-phenylindole (DAPI, 1:1,000, Life Technologies). Following several washes ...
-
bioRxiv - Neuroscience 2022Quote: ... IL-6 (1:4-1:2 dilution, #KMC0061; ThermoFisher Scientific, Waltham, MA, USA), and NfL (1:4 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (1 M) (Invitrogen, cat.#15630080), CellMask membrane dye (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... followed by 3–4-hour incubation at 4°C with protein A/G agarose (20421, Invitrogen). The beads were then collected for western blot detection ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl) containing N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM; Invitrogen) at a final concentration of 10 μM and incubated for 30 min in the dark on ice ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Cells were subcultured at a 1:5 to 1:10 ratio every 2–3 d using Trypsin-EDTA (Gibco #25300-054). The HEK293FT cell line tested negative for mycoplasma with the MycoAlert Mycoplasma Detection Kit (Lonza #LT07-318).
-
bioRxiv - Microbiology 2019Quote: ... A 2 μl volume of cDNA diluted 1:4 (IAV) or 1:5 (reovirus) in molecular biology grade water (Invitrogen) was added to the 384 well plate ...