Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for 6 CHLORO 3 METHYLPYRIDO 3 4 D PYRIMIDIN 4 3H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 4’,6-diamiino-2-phenylindole (DAPI; Invitrogen, Cat# D21490) diluted 1:1000 in PBS was applied for 15 minutes at room temperature with plates subsequently washed ...
-
bioRxiv - Neuroscience 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen Corp., USA) was used for counterstaining ...
-
bioRxiv - Cell Biology 2021Quote: ... 1ml of bone marrow was incubated in one well of 6-well plate with 3 ml StemPro™ MSC serum-free medium (Gibco, Thermo Scientific). Media was changed after every two days until it reached to confluency ...
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Immunology 2022Quote: Total RNA was prepared from one lung lobe collected at 3 dpi using lysing matrix D (MP Biomedical) containing 1 ml of TRIzol reagent (Ambion, Life technologies) and homogenization at 20 s at 4.0 m/s twice using MP Biomedical Fastprep 24 Tissue Homogenizer ...
-
bioRxiv - Immunology 2021Quote: ... Samples from Biosafety Level 3 were inactivated for 2 hours at RT with 4% paraformaldehyde (ThermoFisher Scientific) after extracellular and intracellular staining.
-
bioRxiv - Cell Biology 2019Quote: ... For differentiation cells were switched to M254 medium for 3-4 population doublings (ThermoFisher Scientific, Life Technologies).
-
bioRxiv - Cell Biology 2019Quote: ... For differentiation cells were switched to M254 medium for 3-4 population doublings (ThermoFisher Scientific, Life Technologies).
-
bioRxiv - Neuroscience 2020Quote: ... on a 4-12% bis-tris gel (Genescript) in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen). The gel was then fixed for 30 min in 10% acetic acid/50% methanol ...
-
bioRxiv - Cell Biology 2021Quote: ... For live imaging of cells as described for fatty acids up-take we treated cells at day 5 of differentiation with BODIPY™ (10μM) C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen). In addition ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were passaged after reaching 70-85% confluency (every 3-4 days) using Accutase (Gibco #A11105-01) to disperse into single cells and replated in mTeSR1 supplemented with 1% P/S containing 10 µM Rock Inhibitor (Y-27632 ...
-
bioRxiv - Cell Biology 2021Quote: ... as previously described.13 Cells were passaged every 3-4 days using Collagenase Type IV (Life Technologies). Expression of pluripotency markers was analyzed by flow cytometry using SOX2 (Cell Signaling ...
-
bioRxiv - Molecular Biology 2019Quote: ... Immunoprecipitation was performed at 4°C for 3 hr with 50 µl protein G dynabeads (Thermo Fisher). Beads were washed five times with ice-cold Wash buffer 1 (50 mM Hepes-KOH (pH7.6) ...
-
bioRxiv - Systems Biology 2019Quote: ... 3-30μg protein per well was separated using NuPAGE precast 4-12% polyacrylamide gel system (ThermoFisher Scientific). Immunoblotting was carried out using an X-Cell II blot module (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 hours for E14.5 and 4 hours for E18.5 tissues and then blocked in CAS Block (ThermoFisher) for at least two hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were subcultured every 3-4 days by washing with Dulbecco’s phosphate buffered saline (DPBS, GibcoTM, ThermoFisher) and detached with trypsin (GibcoTM ...
-
bioRxiv - Immunology 2022Quote: ... Epithelium was then collected by centrifugation (3 min, 300g, 4 ºC) and digested by TrypLE express (Gibco) for 1 minute at 37ºC and vortexed ...
-
bioRxiv - Microbiology 2022Quote: ... adding 3 mL HPLC grade methanol and 2 mL HPLC grade chloroform (C297-4, Thermo Fisher Scientific), then shaking at 22°C for 1 hr ...
-
bioRxiv - Microbiology 2023Quote: ... N-(3-triethylammoniumpropyl)-4-(p-diethylaminophenyl-hexatrienyl) pyridinium dibromide (FM4-64) (Thermo Fisher Scientific, Waltham, MA, USA) as previously described (9) ...
-
bioRxiv - Cell Biology 2023Quote: ... hESCs were passaged at 70-80% confluency every 3-4 days into Geltrex coated dishes (Life Technologies) using gentle cell dissociation reagent (STEMCELL-Technologies) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt (DiD, catalog number: D7757) was purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Immunology 2023Quote: ... for 3-4 days to OD 0.6 in tryptone soya broth (Oxoid) supplemented with 10% FCS (Gibco) and the antibiotics above ...
-
bioRxiv - Genomics 2023Quote: ... and CRISPRmap library plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher Scientific L3000001) in lentiviral packaging medium (Opti-MEM (Thermo Fisher Scientific 31-985-070 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Samples were stained 3 days at 4°C with phalloidin (0.66 µM, Alexa Fluor 488, Thermofisher, #A12379) and DAPI (0.3 mg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... Proteins were separated by NuPAGE 3-8% or 4-12 % Tris-Acetate Midi Gel (Invitrogen, Cat# WG1402BX10) and transferred to nitrocellulose membranes (Fisher ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 mM 2-Deoxy-D-glucose (2DG; ACROS Organics), 0.5 μM Thapsigargin (Tg ...
-
bioRxiv - Neuroscience 2023Quote: One million cortical cells and one million striatal cells were suspended in 6 mL D-minimum essential medium (DMEM, GIBCO) with 10% foetal bovine serum (DMEM+) ...
-
bioRxiv - Genetics 2023Quote: 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed ...
-
bioRxiv - Cell Biology 2021Quote: ... 1ml of bone marrow was incubated in one well of 6-well plate with 3 ml StemPro™ MSC serum-free medium (Gibco, Thermo Scientific). Media was changed after every two days until it reached to confluency ...
-
bioRxiv - Genomics 2021Quote: ... One replicate was treated with blasticidin (Gibco, A1113903, 4 µg/mL), and the other replicate was not treated with blasticidin ...
-
bioRxiv - Developmental Biology 2022Quote: ... One volume of 4 °C DMEM (Thermo Fisher Scientific, Cat# 11960044) with 10% fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... and 4 °C hold at one cycle (QuantStudio 3.0, Applied Biosystems). The mean Ct value of technical replicates from the standard curve was analyzed and plotted using The Graph Prism 8.0 ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) was purchased from Invitrogen. Calcein dye ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight in mouse anti-Hu primary antibody at 4°C (1:200 in 3% block; Invitrogen). After three 5-min PB rinses at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... CHIKV was labeled with the lipophilic fluorescent probe DiD (1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt; Life Technologies), as described previously [5] ...
-
bioRxiv - Neuroscience 2020Quote: ... 4) counterstained with the nuclear dye TO-PRO-3 (diluted 1:10’000; Life Technologies, Inc., Gaithersburg, MD, USA). Finally ...
-
bioRxiv - Cell Biology 2022Quote: ... SDS-PAGE was performed using NuPAGE 4-12% Bis-Tris and 3-8% Tris-Acetate gels (Life Technologies). Nitrocellulose membranes were developed with horseradish peroxidase (HRP ...
-
bioRxiv - Genomics 2019Quote: ... Primary antibodies (anti-human CD47-APC; clone CC2C6, BioLegend, Cat. #323123/4, RRID: AB_2716202/3; and clone B6H12.2, ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... at 4°C for 1-3 days followed by secondary antibody (1:500, Thermo Fisher Scientific #A-21206) overnight at 4°C.
-
bioRxiv - Genetics 2020Quote: mRNA was collected from groups of 10 whole larvae (n=3–4 replicates per line) using Trizol (ThermoFisher) and reverse transcribed to cDNA using SuperScript III Reverse Transcriptase (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Antibiotic-Antimycotic Mixed Stock Solution (Nacalai) and were passaged every 3-4 days with TryPLE (ThermoFisher Scientific). For microscopy observations ...
-
bioRxiv - Bioengineering 2020Quote: ... Bodipy FL c16 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid, Thermofisher) was diluted in sterile RPMI-1640 (Corning ...
-
bioRxiv - Molecular Biology 2020Quote: ... a sample of eluates (3%) was separated on acrylamide NuPAGE Novex 4–12% Bis-Tris gels (Life Technologies) and analyzed by silver staining.
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were passaged every 3-4 days with 0.25% trypsin-EDTA solution (Life Technologies, cat. no. 25200-056) and washed with sterile PBS (Life Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... and then diluted into fresh YPD for 3-4 hours before inoculating into 96-well plates (Thermo Scientific) at a starting OD600 between 0.04 to 0.1 ...
-
bioRxiv - Microbiology 2021Quote: ... Paris) and pCMV-VSV-G at a ratio of 4:3:1 with Lipofectamine 3,000 (Thermo Fisher Scientific). Supernatants were collected 48 h after transfection ...
-
bioRxiv - Biochemistry 2022Quote: ... and then analysed on Novex WedgeWell 4-12 % Tris-Glycine Gels or 3-8 % Tris-Acetate gels (Invitrogen). Tris-Glycine gels were run at 180 V for 1 hour at room temperature ...