Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for 6 CHLORO 3 METHYLPYRIDO 3 4 D PYRIMIDIN 4 3H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: HEK293T cells (human female in origin) were cultured every 3-4 days using 0.05% Trypsin EDTA and maintained in DMEM (Gibco, 11965118) supplemented with 10% heat inactivated fetal bovine serum (iFBS ...
-
bioRxiv - Immunology 2023Quote: Following euthanasia, adult zebrafish heads (15 wpf, N=3) were fixed in a solution of 4% methanol-free formaldehyde (Thermofisher) in 60 mM HEPES buffer (pH 7.4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Media was partially renewed every 3-4 days with neuronal differentiation media 2 (NDM2: 1:1 DMEM/F12:NB (Gibco), glutamax (Gibco) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were passaged every 3-4 days at a split ratio of 1:8 following dissociation with 0.5 mM EDTA (Invitrogen AM99260G) in PBS without MgCl2/CaCl2 (Sigma-Aldrich D8662) ...
-
bioRxiv - Genomics 2024Quote: ... and transfer plasmids were transfected at a mass ratio of 2:3:4 with Lipofectamine 3000 (Thermo Fisher Scientific L3000001) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 µL pH 7 TE was added, then 4 µL of 3 M sodium acetate (Fisher, #S210) and 0.4 µL 15 mg/mL GlycoBlue (ThermoFisher, #AM9515) or 0.3 µL 20 mg/mL RNA-grade glycogen (ThermoFisher ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Microbiology 2024Quote: ... The clarified lysate was transferred to a 15 mL column containing 3 mL Ni-NTA Agarose affinity resin equilibrated with buffer A at 4 °C (Invitrogen). The column was washed using a gradient of Buffer A containing 20 mM ...
-
bioRxiv - Cancer Biology 2024Quote: ... then equal quantities of protein lysate (3-10 µg) were separated by SDS-PAGE using 4–12% gradient gels (Invitrogen) and transferred to PVDF membranes ...
-
bioRxiv - Molecular Biology 2024Quote: ... The enteroids were then pelleted at 300 x g for 3 min at 4 °C and washed once with advanced DMEM/F-12 basal media (Gibco). The enteroid pellet was resuspended in the desired volume of IntestiCult complete medium (Stemcell Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... shRNA plasmids were cotransfected with the packaging and envelope plasmids using Lipofectamine 3000 at a ratio of 4:3:1 (#L3000001, Thermofisher) into LentiX cells ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were resolved on precast NuPAGE Novex 4-12% Bis-Tris Gels in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen). Samples were transferred to 0.45 µm nitrocellulose membrane (0.9 A ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were then dried at 100°C and derivatized with 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole (Acros Organics, ThermoFisher Scientific) prior to reverse-phase HPLC (Agilent 1100 series ...
-
bioRxiv - Cell Biology 2024Quote: ... The flow-through was then dried in a speed-vac and derivatized with 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole (Acros Organics, ThermoFisher Scientific) prior to reverse-phase HPLC (Agilent 1100 series ...
-
bioRxiv - Neuroscience 2021Quote: ... Larvae (6 dpf) were transferred to a 3 cm Petri dish (Thermo Scientific) and allowed to acclimatize for 5 min before video recording ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 M-tumours and 6 RE-tumours conserved in RNA-later (ThermoFisher,USA) used for RNA extraction ...
-
bioRxiv - Microbiology 2019Quote: ... 6 ug RNA was treated with 3 units of Turbo DNase I (Invitrogen) for 45 min at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and rinsed 3 times with Dulbecco’s phosphate buffer saline (D-PBS) (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 mM 3’-d-GTP [>99% purity for UTP and CTP (ThermoFisher); ≥95% purity for 3’-dGTP (Jena Bioscience)] and incubated 2 min at 37°C (to “chase,” and thereby to stabilize ...
-
bioRxiv - Cancer Biology 2023Quote: ... and siTACC3#3: D-004155-04-0005) using Lipofectamine 2000TM (Invitrogen, CA, USA) transfection reagent as described previously24 ...
-
bioRxiv - Biophysics 2021Quote: ... Cell nucleus were stained with DAPI (4’,6-diamidino-2-phenylindole, Invitrogen) for 10 min at room temperature ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... All preparations were stained with 4’,6’-diamidino-2-phenylindole (DAPI, Invitrogen) for 10 minutes to label nuclei and mounted with Fluoroshield medium (Sigma) ...
-
bioRxiv - Bioengineering 2022Quote: ... Nuclei were counterstained with 4’,6’-diamidino-2-phenyliondole (DAPI; Invitrogen, D1306). Coverslips were mounted with ProLong™ Gold Antifade (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... 30 min incubation with 4′,6-diamidino-2-phenylindole (DAPI, Life Technologies) (1:1000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... slides were briefly stained with 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher) to reveal the nuclei ...
-
bioRxiv - Genomics 2020Quote: ... followed by nuclear staining with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen). Both bright field and nuclear staining images were separately taken using a Keyence BZ-X700 All-in-One microscope.
-
bioRxiv - Cancer Biology 2019Quote: ... ProLong Gold Antifade Mountant with 4′,6-diamidino-2-phenylindole (Life Technologies) was used for mounting ...
-
bioRxiv - Biophysics 2019Quote: ... DNA was stained with DAPI (4’,6-diamidino-2-phenylindole, Molecular Probes) at 2 µg/ml ...
-
bioRxiv - Microbiology 2019Quote: All samples were counterstained with DAPI (4’,6-diamidino-2-phenylindole; Invitrogen, Fisher Scientific AG ...
-
bioRxiv - Biochemistry 2020Quote: ... USA) and 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Immunology 2020Quote: ... cells were incubated with 4′,6-diamidino-2-phenylindole (DAPI) (ThermoFisher Scientific) for 10 minutes at room temperature in the dark ...
-
bioRxiv - Bioengineering 2021Quote: ... Nuclei were stained with 4’,6-Diamidin-2-phenylindol (DAPI, Invitrogen, #D1306) 1:10,000 in 0.01 M PBS.
-
bioRxiv - Neuroscience 2021Quote: ... at 1:200 and (4’,6-diamidino-2-phenylindole) DAPI (Fisher Scientific) at 1:10,000.
-
bioRxiv - Cell Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Invitrogen, Thermo Fisher Scientific) was added to visualize cell nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Invitrogen, Thermo Fisher Scientific) was added to visualize cell nuclei ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were afterwards counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen). The primary antibodies used were nephrin (Progen ...
-
bioRxiv - Microbiology 2020Quote: ... Cell nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) to calculate the CC50 values ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Neuroscience 2020Quote: ... and 4’,6’-diamidino-2-phenylindole dihydrochloride (1 µg/ml, Life Technologies) for 2 hr ...
-
bioRxiv - Physiology 2020Quote: ... Invitrogen™ DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (ThermoFisher Scientific #D1306) and used at the concentration of 1.0 ug/mL in wash solution.
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D3571). Primary antibodies used for immunoblotting include reovirus-specific polyclonal rabbit antiserum ...
-
bioRxiv - Cell Biology 2021Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole; D1306, Thermo Fisher Scientific, Reinach, Switzerland) was then used for nuclear staining ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by 4–6 hr incubation with Protein G Dynabeads (Life Technologies). Beads were washed four times with 1 mL of cold radioimmunoprecipitation assay buffer (RIPA ...
-
bioRxiv - Immunology 2022Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) or Live/dead fixable blue (ThermoFisher) was used to exclude dead cells.
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 4′,6-diamidine-2-phenylindole dihydrochloride (DAPI) were purchased from Thermo Fisher Scientific (CA ...
-
bioRxiv - Cell Biology 2022Quote: ... DAPI was used (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10,000, Invitrogen). For staining of lipid droplets ...