Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 6 CHLORO 3 METHYLPYRIDO 3 4 D PYRIMIDIN 4 3H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2020Quote: ... DAPI ((4’,6-diamidino-2 phenylindole, Invitrogen) was added and samples were covered with coverslips ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) was added to embryos (10 μg/mL in PBST ...
-
bioRxiv - Bioengineering 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen) allowed visualization of the nucleus (1:5000 dilution) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Plant Biology 2021Quote: ROMT2-3 were amplified using TOPO-D (Invitrogen) compatible primers from cDNA derived from grapevine senescent leaves ...
-
bioRxiv - Molecular Biology 2021Quote: ... antibodies overnight at 4°C and then incubated for an additional 3 hours at 4°C with 50 μL DynabeadsTM protein G (Life Technologies, 10004D). Following three washes with 1% Triton-TBS lysis buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... Human naive PSCs were passaged as single cells every 4 days at split ratio 1:3 or 1:4 following dissociation with TrypLE (Gibco 12563-029) for 10 minutes (min ...
-
bioRxiv - Microbiology 2020Quote: ... Fungal hyphae were stained with 0.5 mM 4.4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (C1-BODIPY 500/510 C12, Thermo Fisher Scientific) or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Human naive PSCs were passaged as single cells every 4 days at split ratio 1:3 or 1:4 following dissociation with TrypLE (Gibco 12563-029) for 10 minutes at room temperature (RT) ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Microbiology 2022Quote: ... pTG-Luc and SARS2-COV2 spike expression vector were transfected into HEK 293T cells at the ratio of 3:4:3 using Lipofectamine 3000 transfection reagent (ThermoFisher Scientific, Waltham, MA). Accession IDs of the spike proteins used in the study were ...
-
bioRxiv - Cell Biology 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (cat#D-1306) and TRIzolTM (cat#15596018) were purchased from ThermoFisher Scientific (Waltham ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1% penicillin/streptomycin with passaging every 3–4 days using in DPBS (Life technologies) supplemented with 0.5 mM EDTA (Life technologies ...
-
bioRxiv - Genomics 2020Quote: ... Abl.3 and Abl.4 (13) were cultured in Roswell Park Memorial Institute medium (Gibco), containing 15% FBS (Sigma) ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... CDH11 #4: 5’-CCUUAUGACUCCAUUCAAA-3’ using Lipofectamine RNAiMAX transfection reagent (13778030; ThermoFisher Scientific, Waltham, MA) in serum-free DMEM ...
-
bioRxiv - Cell Biology 2021Quote: HAEC cells (passage 3-4) were lysed in ice-cold RIPA buffer (ThermoFisher, cat# 89900) containing protease and phosphatase inhibitors (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell number was determined every 3-4 days using the Countess automated cell counter (Invitrogen). 20,000 cells were then re-plated with fresh media and compound ...
-
bioRxiv - Neuroscience 2019Quote: ... Lines were passaged every 3-4 days using enzymatic detachment with Stempro Accutase (ThermoFisher; A1110501) for 5 minutes and re-plated in mTeSR1 medium with 10µM Rock Inhibitor (Y2732 ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was isolated from approximately 3-4 x 107 cells using TRIzol reagent (Thermo Fisher), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... for 3-4 hr in the presence of brefeldin A (BFA; 10ug/mL; Life Technologies).
-
bioRxiv - Neuroscience 2022Quote: Hippocampal neurons were transfected at day in vitro (DIV)3-4 using Lipofectamine 2000 (Invitrogen). Shortly ...
-
Migration and establishment of progenitor pool of melanocytes is governed by SEMA3E-PLXND1 signalingbioRxiv - Developmental Biology 2023Quote: ... cells were switched to M254 medium for 3-4 population doublings (Thermofisher Scientific, Life Technologies).
-
Migration and establishment of progenitor pool of melanocytes is governed by SEMA3E-PLXND1 signalingbioRxiv - Developmental Biology 2023Quote: ... cells were switched to M254 medium for 3-4 population doublings (Thermofisher Scientific, Life Technologies).
-
bioRxiv - Cell Biology 2023Quote: ... followed by a second round of transfection 3-4 hours later using RNAiMax (Life Technologies) according to the manufacturer’s instructions with final siRNA concentration of 50 nM and 20 nM for Sac2 and OSBP ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 3-4 days before they were collected directly in TRIzol reagent (Invitrogen cat#15596026). Before collection ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3-4 μm paraffin sections were prepared with a HM 355S microtome (Fisher Scientific, 10862110), deparaffinized and rehydrated up to 96% ethanol (v/v) ...
-
bioRxiv - Immunology 2023Quote: ... Cell passaging was performed every 3 to 4 days using 0.05% Trypsin-EDTA solution (Gibco). Expi293F cells were maintained in Expi293 Expression Medium (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Microbiology 2022Quote: ... PAFB was labelled with the green fluorophore 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-propionyl ethylenediamine hydrochloride (BODIPY™ FL EDA, Invitrogen, Waltham, MA, USA) as described (32).
-
bioRxiv - Microbiology 2022Quote: ... one volume of 4% Agarose Gel (Gibco, Life Technologies) was mixed by a three-volume of preheated IAV growth media to make the overlay gel liquid and kept at 37 ℃ water bath ...
-
bioRxiv - Microbiology 2022Quote: ... one volume of 4% Agarose Gel (Gibco, Life Technologies) was mixed by a three-volume of preheated IAV growth media to make the overlay gel liquid and kept at 37 ℃ water bath ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Pathology 2023Quote: ... were incubated with 10 µM red fluorescent Lipophilic Tracer DiD (1,1’-dioctadecyl-3, 3, 39, 39-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt; Thermo Fisher Scientific, Waltham, MA, USA) and/or 2 mM SYTO RNA-Select Green Fluorescent Cell Stain Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher).
-
bioRxiv - Neuroscience 2019Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Life Technologies) staining was added to visualize nuclei.
-
bioRxiv - Bioengineering 2020Quote: ... 4’-6-diamidino-1-phenylindole (DAPI, Life Technologies) was applied at 1 μg/mL for 90 minutes to stain the nuclei and the samples were washed and mounted with AquaPoly/Mount (Polysciences) ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6- diamidino-2-phenylindole (DAPI; Invitrogen D1306) was added during the secondary antibody incubation at a concentration of 700 ng/ml ...
-
bioRxiv - Neuroscience 2019Quote: ... counterstained with DAPI (4’,6-diamidino-phenylindole, Invitrogen) for 45 min (both steps at room temperature) ...
-
bioRxiv - Pathology 2021Quote: ... 4’,6-Diamidino-2-phenylindole (DAPI, D21490, ThermoFisher) stain was done for 15 min at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... and 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen). Confocal analyses of stained slides were performed using a TCS SP8 Laser Scanning Spectral Confocal Microscope (LEICA Microsystems) ...
-
bioRxiv - Molecular Biology 2019Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher) and ActinRed™ 555 ReadyProbes™ (Molecular Probes ...
-
bioRxiv - Neuroscience 2022Quote: DAPI (4′,6-diamidino-2-phenylindole, D1306, Invitrogen) staining was performed by incubation at 1:500 for 10 min in DPBS ...
-
bioRxiv - Neuroscience 2022Quote: ... DAPI (4’, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was applied to samples at a concentration of 0.1μg/ml ...
-
bioRxiv - Bioengineering 2022Quote: ... DAPI (4’ −6’ -diamino-2-phenylindole, dilactate; Invitrogen) was used for nuclear staining ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher) was added for 30 min at room temperature before the secondary antibodies were washed out in PBS 3x for 15 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, D3571) was added for 5 minutes in the dark ...
-
bioRxiv - Cancer Biology 2023Quote: ... DAPI (4-6-diamindino-2-phenylindole; Molecular Probes) was used to detect DNA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM 2-deoxy-D-glucose (2DG; ACROS Organics), 2 μM PERK inhibitor (PERKi ...