Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... and primers (46) (5′-CAGAGATCGATCTGTTTCCTTGACACGCGTGCCACCATGTTCGTGTTCCTG-3′ and 5′-AATCTGTGTGCAGGGCGGCCGCTCAGGTGTAGTGCAGCTTCACG-3′) and cloned by using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Plant Biology 2024Quote: ... The NTF sequences were amplified using primers (5’-CACCATGGATCATTCAGCGAAAACCACACAG-3’ and 5’-TCAAGATCCACCAGTATCCTCATGC-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). The CAB2 promoter region (324 bp ...
-
bioRxiv - Cell Biology 2024Quote: ... or siMIIP (s34150, sequence sense 5’- AGGAGUUUCGGGAAACCAAtt-3’), or siPOC5 (AD39Q91, sequence sense 5’- CAACAAAUUCUAGUCAUACUU-3’) using Lipofectamine RNAi MAX reagents (Invitrogen). Medium was changed 5-6 hours post-transfection ...
-
bioRxiv - Biophysics 2021Quote: ... plus 1% penicillin/streptomycin in a humidified incubator at 37 °C and 5% CO2 and passaged every 3-4 days using 0.05% of Trypsin-EDTA (Thermo Fisher Scientific) to lift the cells from the culture dish ...
-
bioRxiv - Cell Biology 2020Quote: ... A pool of 4 siRNAs targeting mouse SNAP-47 and control Luciferase siRNA (Target Sequence: 5’-CGTACGCGGAATACTTCGA-3’) (Dharmacon, Thermofisher Scientific) were electroporated along with GFP into E15.5 cortical neurons (2 µg GFP + 50 pmol siRNAs) ...
-
bioRxiv - Immunology 2021Quote: ... The final wash was followed by the addition of Nitro-blue Tetrazolium Chloride/5-bromo-4-chloro 3 ‘indolyl phosphate p-toludine salt (NBT/BCIP chromagen) substrate solution (Thermo Scientific) for 7 min ...
-
bioRxiv - Immunology 2022Quote: ... 700 μg of protein were mixed and rotated with 0.5 μg of STING antibody for 3 h at 4 °C after which 25 μL of Dynabeads Protein G (Invitrogen, 10004D) were added to each sample and rotated for an additional hour ...
-
bioRxiv - Physiology 2024Quote: ... plus 1% penicillin/streptomycin in a humidified incubator at 37 °C and 5% CO2 and passaged every 3-4 days using 0.05% of Trypsin-EDTA (Thermo Fisher Scientific) to lift the cells from the culture dish ...
-
bioRxiv - Cell Biology 2023Quote: ... maintained at 37° C and 5% CO2 and passaged every 3-4 days using trypsin-EDTA 0.05% (Life Technologies, Paisley, UK) to detach the cells ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein– antibody complexes were visualized using the alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium for color development (Life Technologies).
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Genomics 2020Quote: ... 4 × 10−5 % biotin (Life Technologies #B1595), 13.4 g/ l (1.34% (w/v) ...
-
bioRxiv - Neuroscience 2022Quote: ... forward−5’ AAAACTAGTGAACCGTCAGATCCGCTAG-3’;PspXI (Thermo Fisher Scientific), reverse ...
-
bioRxiv - Microbiology 2021Quote: ... R2 5’-gtgccctttctccatttggt-3’ using superscript III (Invitrogen) and SYBR green (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... and reverse DnTag 5’ – CACGACGCTCTTCCGATCTAGTANNNNCGCCATCCAGTGTCGAAAAGTATC-3’ (Invitrogen, UK) primer sequences comprised part of the Illumina adaptor sequence (underlined) ...
-
bioRxiv - Genomics 2021Quote: ... Reverse UpTag primer 5’ – CACGACGCTCTTCCGATCTAGTANNNNGGGGACGAGGCAAGCTAAGATATC-3’ (Invitrogen, UK) and reverse DnTag 5’ – CACGACGCTCTTCCGATCTAGTANNNNCGCCATCCAGTGTCGAAAAGTATC-3’ (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... on a QuantStudio 3 or 5 instrument (ThermoFisher). A standard curve of viral RNA of known copy number was run in parallel.
-
bioRxiv - Cell Biology 2024Quote: ... 5’-UAGUGACUUCUGGAAAUUCag-3’ (antisense) (Ambion by Life Technologies); siRNA#4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-UAGUGACUUCUGGAAAUUCag-3’ (antisense) (Ambion by Life Technologies); siRNA#4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Immunology 2023Quote: ... then resuspended with 5 uM DiSBAC2(3) (Invitrogen), 2.5 uM DCFDA (AdipoGen Life Sciences ...
-
bioRxiv - Bioengineering 2020Quote: ... Acetyl-H3K9 (AC-H3K9) (Invitrogen # MA5-11195, 1:400) or RNA polymerase II (POL-II ...
-
bioRxiv - Genetics 2021Quote: ... 0.25 mg/mL acetyl-BSA (Thermo Fisher Scientific, AM2614), and 2 U of Phusion Hot Start II DNA Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... acetyl ester (CM-H2DCFDA; Invitrogen USA, Thermo Fisher Scientific). Mtb cells are grown in Middlebrook 7H9 broth till the OD reaches 0.5-0.6 ...
-
bioRxiv - Microbiology 2023Quote: ... acetyl ester (CM-H2DCFDA; Invitrogen USA, Thermo Fisher Scientific). Mtb cells are grown in Middlebrook 7H9 broth till the OD reaches 0.5-0.6 ...
-
bioRxiv - Bioengineering 2020Quote: ... The marrow was flushed out of the bones via 2 - 5 mL 4 °C DPBS (Dulbecco’s Phosphate-Buffered Saline; Cat. No. 21-031-CV; Gibco) injection ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated 5 minutes with at room temperature with 500 ng/ml 4’,6-Diamidino-2-Phenylindole Dilactate (DAPI; ThermoFisher) in DPBS and mounted in ProLong®Gold (ThermoScientific).
-
bioRxiv - Immunology 2022Quote: ... Cells then were washed twice with FACS buffer and stained for 5 minutes at 4°C with 0.5 mg/mL of 40,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher). PE and DAPI staining were measured with an iQue Screener Plus flow cytometer (Intellicyt ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were stained for 5 min with 1 μg/ml 300 nM 4′,6-diamidino-2-phenylindole (Life Technologies) to visualize nuclei ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was isolated from sorted 2-3×10^5 CD34+ cells using the mirVANA miRNA isolation kit (Thermo Fisher) and subsequently processed using the Small RNA Library Prep kit (Norgen Biotek) ...
-
bioRxiv - Biophysics 2021Quote: ... slides were rinsed in PBS for 3 x 5 mins and stained with 1 %g/mL 4,6-diamino-2-phenylindole (DAPI - Molecular Probes) for 3 mins in the dark at RT ...
-
bioRxiv - Microbiology 2021Quote: ... and cDNAs were synthesized using SARS-CoV-2 nucleocapsid (N) reverse primer N660R (5’-AGCAAGAGCAGCATCACCGCCATTGCCAGC-3’) and M-MLV reverse transcriptase (Invitrogen). Then ...
-
bioRxiv - Biochemistry 2022Quote: ... Peptides were separated using 50 cm Acclaim PepMap 100 analytical column (75 μm ID, 3 μm C18) in conjunction with a Pepmap trapping column (100μm × 2 cm, 5 μm C18) (Thermo Scientific) analysed with Orbitrap Fusion Tribrid mass spectrometer (Thermo-Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... For the construction of the RNH2A KO clones, RNASEH2A (Chr19, exon 2) gRNA (5’-TAACAGATGGCGTAGACCAT-3’) was cloned into GeneArtTM CRISPR Nuclease Vector with OFP reporter (Invitrogen) following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: Duplex of the MEF2C enhancer sequence containing a mutation site [5′-ATGTATTTTTCTGCAATAAGT-3′ (×2)] in human genomic DNA were synthesized (Invitrogen). Additionally ...
-
bioRxiv - Pathology 2022Quote: ... 5 mg of 5-ethynyl-2′-deoxyuridine (EdU, A10044, Invitrogen) was dissolved in 1 ml of PBS as a stock solution ...
-
bioRxiv - Microbiology 2023Quote: 3’(4-Hydroxyphenyl)-fluorescein (HPF; Molecular Probes, OR, USA) was used for detecting •OH production (Avci et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplicon of the-2.3etv2 promoter was synthesised from zebrafish genomic DNA with a forward primer 5’- TATAGGGCGAATTGggtaccTTCAGTAAGCAGACTCCTTCAATCA -3’ and a reverse primer 5’- AGCTGGAGCTCCAccgcggTTCGGCATACTGCTGTTGGAC -3’ by Phusion High-Fidelity DNA Polymerase (Thermo Scientific) as an insert for In-Fusion Cloning (Takara Bio ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination (VP1 to 2C) was amplified using primers PV3-F (5′-GCAAACATCTTCCAACCCGTCC-3′) and PV1-R (5′-TTGCTCTTGAACTGTATGTAGTTG-3′) and Taq polymerase (Life Technologies) with an initial denaturing at 94°C for 3 min ...