Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Cells were washed 3x with 1x PBS (5 minutes per wash) prior to 4’,6-diamidino-2-phenylindole (DAPI; 1:3000; Thermo Fisher) incubation for 5 minutes at room temperature to stain nuclei ...
-
bioRxiv - Genetics 2022Quote: ... Ly6Chi monocytes were labeled by intraperitoneal injection of 4 mg/mL of Edu (5-ethynyl-2’-deoxyuridine) from Life technologies (NY), and mice were euthanized after 5 days to assess baseline recruitment or 21 days to assess for retention ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Genetics 2020Quote: ... boiled in reducing sample buffer for 5 min and resolved on 4–12% Bis-Tris Bolt gels and transferred using an iBlot 2 (Thermo Fisher). Blots were blocked in 2.5% milk in 1% TBS-Tween before staining with antibodies (Table S5) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were dissociated into single cells with TrypLETM for 4-5 minutes at 37 C and seeded into 2 % Geltrex coated 96- or 12-well plates (Fisher Scientific) in Essential 8TM Medium (Gibco ...
-
bioRxiv - Microbiology 2022Quote: ... A 3% agarose gel with 4 μL ethidium bromide was loaded with 5 μL PCR reaction and 2 μL GeneRuler 100bp ladder Plus (Thermo Fisher) and run for 40 minutes at 100 volts ...
-
bioRxiv - Microbiology 2023Quote: For detection of NO in treated mycobacteria DAF-FM diacetate (4-Amino-5-Methylamino-2’,7’-Difluorofluorescein),27 purchased from Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... and counterstained with 5 μg/mL of 4′,6-diamidino-2-phenylin-dole (DAPI) or propidium iodide (Molecular Probes, Life Technologies) for 10 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... and counterstained with 5 μg/mL of 4′,6-diamidino-2-phenylin-dole (DAPI) or propidium iodide (Molecular Probes, Life Technologies) for 10 min ...
-
bioRxiv - Bioengineering 2023Quote: ... Hydrogels were washed extensively with PBS and activated via photoirradiation (365 nm, 0.8 mW for 5 minutes) with sulfosuccinimidyl-6-4’-azido-2’-nitrophenylamino hexanoate (Sulfo-SANPAH; Thermo Scientific Pierce). To do so ...
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Immunology 2024Quote: ... For T cell panels (Supplemental table 2, 4, 5, 6) we fixed cells with the FOXP3 Fixation/Permeabilization Buffer Kit (Thermo Fisher) and conducted intracellular/nuclear stains using the FOXP3 Permeabilization Buffer (Thermo Fisher ...
-
bioRxiv - Genomics 2024Quote: ... was prepared fresh with the 3’aminated 5’ caged oligo root carrying a terminal Cy3 dye (2 μM BL003 for the single-cycle experiment and 2 μM BL728 for the 4-cycle experiment) and a bifunctional crosslinker BS(5)PEG (Thermo Scientific) (5 μM in dimethylformamide) ...
-
bioRxiv - Microbiology 2024Quote: ... 20% volume of 1M 2-morpholin-4-ylethanesulfonic acid (MES) pH 5 and Immobilized Protein G resin (Thermo Scientific Prod#20397) were added to supernatant and sample was incubated overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were washed 3×5 min in PBS and incubated for 2 h with an Alexa Fluor® Plus 555-conjugated secondary antibody (Invitrogen A32816) diluted in the blocking solution ...
-
bioRxiv - Synthetic Biology 2024Quote: ... HEK293FT and HEK293FT-LP cells were subcultured at a 1:5 to 1:10 ratio every 2–3 d using Trypsin-EDTA (Gibco 25300-054). All HEK293FT cell lines generated by engineering either the HEK293FT or HEK293FT-LP parent cell lines were cultured in the same way ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; 5 mg per kg body weight, Invitrogen) dissolved in sterile phosphate buffer solution (PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Immunology 2022Quote: Caspase-3 activity was determined using EnzChek™ Caspase-3 Assay Kit #2 (Thermo Fisher).
-
bioRxiv - Microbiology 2021Quote: ... (75 mm i.d. 3 2 cm, Acclaim PepMap100 C18 3 mm, 100 A°, ThermoFisher Scientific) and separated over an EASY-Spray column ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2-deoxy-2-[(7-nitro-2,1,3-benzoxadiazol-4-yl)amino]- D-glucose (2-NBDG) (Invitrogen N13195) was used as a probe for monitoring glucose uptake ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were infected in a BSL-3 lab with the UF-1 strain of SARS-CoV-2 at MOI of 4 in media containing 3% low IgG FBS (Fisher Scientific, Cat. SH30070.03).
-
bioRxiv - Neuroscience 2021Quote: ... Samples were incubated at 4°C for 3 hours on a rotator before being placed in a DynaMag™-2 magnetic rack (Thermo Scientific, 12321D) and washed twice with TBS+NP40 wash buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... Fluorescence-labelled 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (NBD-PE) was obtained from Molecular Probes (Eugene, Oregon, US). Sucrose was purchased from XiLong Chemical Co. ...
-
bioRxiv - Bioengineering 2020Quote: ... 3) latrunculin-b (Lat-B; 2 μM; Fisher Scientific), 4 ...
-
bioRxiv - Neuroscience 2021Quote: ... passaged 1:2-3 when confluent using Tryple (ThermoFisher). When thawing or passaging the iPSCs ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM 2-deoxy-D-glucose (2DG; ACROS Organics), 2 μM PERK inhibitor (PERKi ...
-
bioRxiv - Microbiology 2024Quote: ... glass (2 gm, 3 mm bead diameter; Fisher Scientific) and polystyrene (24-well plates ...
-
bioRxiv - Plant Biology 2022Quote: ... 2–3 μg were treated with Turbo DNase (Ambion). RNA was circularized using T4 RNA ligase and reverse transcription was performed with the Superscript III (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse-anti-desmocollin-2/3 7G6 (1:250, Invitrogen 32-6200 ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-2 drops of CytoSeal (Thermofisher, 8312-4) were placed on each before mounting a coverslip ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6- diamidino-2-phenylindole (DAPI; Invitrogen D1306) was added during the secondary antibody incubation at a concentration of 700 ng/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2-4 μg/ml of Blastidin (ThermoFisher Scientific) and 100-400 μg/ml of G418 (ThermoFisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... 4’,6-Diamidino-2-phenylindole (DAPI, D21490, ThermoFisher) stain was done for 15 min at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... and 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen). Confocal analyses of stained slides were performed using a TCS SP8 Laser Scanning Spectral Confocal Microscope (LEICA Microsystems) ...
-
bioRxiv - Immunology 2020Quote: ... Puromycin (2-4 μg/ml, Thermo Fisher, A113803) was used for TRIM25-knockdown HEK293T cell selection ...
-
bioRxiv - Neuroscience 2022Quote: DAPI (4′,6-diamidino-2-phenylindole, D1306, Invitrogen) staining was performed by incubation at 1:500 for 10 min in DPBS ...
-
bioRxiv - Neuroscience 2022Quote: ... DAPI (4’, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was applied to samples at a concentration of 0.1μg/ml ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher) was added for 30 min at room temperature before the secondary antibodies were washed out in PBS 3x for 15 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... DAPI (4-6-diamindino-2-phenylindole; Molecular Probes) was used to detect DNA ...
-
bioRxiv - Bioengineering 2022Quote: ... DAPI (4’ −6’ -diamino-2-phenylindole, dilactate; Invitrogen) was used for nuclear staining ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 ng/ml BMP-4 (ThermoFisher Scientific). Then ...
-
bioRxiv - Molecular Biology 2024Quote: 4’,6-diamidino-2-phenylindole - DAPI (Invitrogen, R37606); Ulex europaeus agglutinin-I ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of MVs were incubated with the FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Thermofisher) at 2 µg/mL in a final volume of 100 µL in a 96-well black plate ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in 2-(N-(7-nitrobenz-2-oxa-1,3-diaxol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Invitrogen) (20 µM ...
-
bioRxiv - Physiology 2021Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in saline solution at 5 mg/ml ...