Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2023Quote: FOs from 2 or 3 independent differentiations were fixed using 4% paraformaldehyde (Thermo Scientific) in PBS (Gibco ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed MTT (3-(4,5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) assay (cat no. V13154; Thermo Fisher) for determining cell viability after different tunicamycin treatments as per the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... CDH11 #4: 5’-CCUUAUGACUCCAUUCAAA-3’ using Lipofectamine RNAiMAX transfection reagent (13778030; ThermoFisher Scientific, Waltham, MA) in serum-free DMEM ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Microbiology 2023Quote: ... SuperSignal Chemiluminescent substrate and 2’,7’-dichlorodihydrofluorescein diacetate acetyl ester (H2DCFDA) were from Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2022Quote: ... Acetyl-p53 (Lys382) (Invitrogen, 710294), Anti-p53 (acetyl K120 ...
-
bioRxiv - Microbiology 2024Quote: ... 0.1% acetyl-BSA final (Invitrogen)) ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1% acetyl-BSA final (Invitrogen)) ...
-
bioRxiv - Genetics 2023Quote: ... acetyl ester (CM-H2DCFDA; Invitrogen). Medium from larvae was placed in culture media containing 5 μM CM-H2DCFDA for 90 minutes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was discarded and the pellet was resuspended in 5 mL liquid KNOP supplemented with 2% (w/v) sucrose (#S/8600/60, Fisher) and 100 μM 3’,5’-dimethoxy-4’-hydroxyacetophenone (acetosyringone) (#115540050, Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (#D8418 ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 5 µg / µl 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) and slides were mounted with FluoromountG (SouthernBiotech).
-
bioRxiv - Cell Biology 2020Quote: ... SUMO-2/3 (Invitrogen); β-Catenin (BD Transduction Laboratories) ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Microbiology 2020Quote: ... Fungal hyphae were stained with 0.5 mM 4.4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (C1-BODIPY 500/510 C12, Thermo Fisher Scientific) or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16 ...
-
bioRxiv - Cell Biology 2023Quote: ... siCT (5’- CGUACGCGGAAUACUUCGAtt-3’, Ambion), siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-5 μL RNAiMAX (Invitrogen) were added to 500 uL serum-free RPMI-1640 and incubated at room temperature for 5 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Bioengineering 2024Quote: ... DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Cas. No. 28718-90-3, Thermo Scientific GmbH, Germany), Tween 20 (Art ...
-
bioRxiv - Developmental Biology 2022Quote: ... All other lines were passaged at approximately 80% confluency (every 4-5 days on average) as tiny clusters (3-5 cells on average) using 0.5 mM EDTA (15575020, Gibco, concentration 10 mM).
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were also stained for 30 minutes simultaneously with 1 μM 2′-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]−2,5′-bi-1H-benzimidazoletrihydrochloride trihydrate (Hoechst 33342, Fisher Scientific) for nuclear visualization and cell localization ...
-
bioRxiv - Cancer Biology 2020Quote: ... The medium was changed every 2-3 days and organoids were passaged every 2-4 weeks by dissociation with 1 ml of TrypLE Express (Life Technologies) at 37°C for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... acetyl ester (CM-H2DCFDA) probe (Invitrogen) for 45 minutes at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... Acetyl-Histone H4 (PA5-40084, Invitrogen); Linear ubiquitin (LUB9 ...
-
bioRxiv - Systems Biology 2022Quote: ... and 0.2% N-acetyl-cysteine (Gibco)] with the addition of 50ng/ml EGF (Peprotech) ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...