Labshake search
Citations for Thermo Fisher :
2901 - 2950 of 3690 citations for CdSeTe ZnS Quantum Dots NIR region Water solvent 760nm since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Native MS analyses were performed on a modified LCT time-of-flight instrument (Waters) or a standard Exactive Plus EMR Orbitrap instrument (ThermoFisher Scientific). Before analysis ...
-
bioRxiv - Biochemistry 2021Quote: Samples were analyzed by HPLC-ESI-MS/MS using a system consisting of a high-performance liquid chromatograph (nanoAcquity, Waters) connected to an electrospray ionization (ESI) Orbitrap mass spectrometer (LTQ Velos, ThermoFisher Scientific). HPLC separation employed a 100 x 365 mm fused silica capillary micro-column packed with 20 cm of 1.7µm-diameter ...
-
bioRxiv - Cancer Biology 2021Quote: ... and phosphatase/protease inhibitors in water) and addition of a 1:1 ratio of protein A and G magnetic beads (Life Technologies) were used to bind crosslinked protein/DNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... Protein samples were reconstituted in solvent A (water/ACN [98: 2 v/v] with 0.1% formic acid) and separated using a C18-PepMap column (Thermo Fisher Scientific) with a solvent gradient of 2–100% Buffer B (0.1% formic acid and 98% acetonitrile ...
-
bioRxiv - Cell Biology 2020Quote: Approximately 1 µg of TMT-labeled peptide from each fraction was analyzed by nanoscale liquid chromatography – tandem mass spectrometry (LC-MS/MS) on a nanoAquity UPLC (Waters) coupled to an Orbitrap Fusion Lumos Tribrid mass spectrometer (ThermoFisher Scientific). Peptides were first trapped on a column at 99.9% water and 5 µL/min ...
-
bioRxiv - Cell Biology 2020Quote: ... The air-dried DNA was dissolved in 19 µL of sterile water and treated with Swa1 in two cycles (2×2 FastDigest units, Thermo Scientific), each cycle of 1 hour at 37°C (total volume 25 µl ...
-
Splicing variation of BMP2K balances endocytosis, COPII trafficking and autophagy in erythroid cellsbioRxiv - Cell Biology 2020Quote: ... Peptide mixtures were analyzed by liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) using Nano-Acquity (Waters Corporation) UPLC system and LTQ-FT-Orbitrap (Thermo Scientific) mass spectrometer ...
-
bioRxiv - Cell Biology 2020Quote: ... two 4 µm thick sections were cut on a Leica RM2255 microtome with integrated cooling station and water basin and transferred to adhesive glass slides (Superfrost Plus, Thermo Fisher). Subsequently ...
-
bioRxiv - Cell Biology 2020Quote: ... Peptide mixtures were analysed by nanoflow reversed-phase liquid chromatography tandem mass spectrometry (LC-MS/MS) on an M-Class HPLC (Waters) coupled to a Q-Exactive Orbitrap mass spectrometer (Thermo Fisher). Peptide mixtures were loaded in buffer A (0.1% formic acid ...
-
bioRxiv - Cancer Biology 2020Quote: ... Slide preparation for RPPA did not involve staining with eosin after the hematoxylin but included color development in Scott’s Tap Water (Thermo Fisher Scientific) and two final drying steps in xylenes ...
-
bioRxiv - Neuroscience 2021Quote: ... and Standard Control (5’ CCTCTTACCTCAGTTACAATTTATA 3’) MOs (GeneTools) were diluted in distilled water and co-injected with Cascade Blue labelled dextran (Molecular Probes) into one- to two-cell wild-type (Tübingen ...
-
bioRxiv - Biophysics 2022Quote: ... The samples were then washed with ultrapure water and allowed to dry for one hour in a laminar flow hood (1300 Series A2, Thermo Scientific). Once dry ...
-
bioRxiv - Physiology 2022Quote: ... Membranes were briefly rinsed in double-distilled water and equal protein transfer was confirmed by incubating the membranes in stain (Pierce Reversible Memcode Stain, Thermo Scientific) for 5 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Following this incubation coverslips were washed twice with cell culture grade water and were incubated at 37°C with 10 µg/mL mouse Laminin (ThermoFisher, 23017015) for 5 hours before plating ...
-
bioRxiv - Neuroscience 2021Quote: ... For MS of permethylated glycolipids in positive ion mode,∼0.4 nmol of permethylated total glycolipids were dissolved in 50 µl of 1 mM sodium acetate in methanol/water (1:1) for infusion into a linear ion trap mass spectrometer (Orbi-LTQ; ThermoFisher Scientific) using a nanospray source at a syringe flow rate of 0.40 µl/min and capillary temperature set to 210 °C [18–21] ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was diluted 1:5 in water and 2μl was used for real-time PCR using SYBR® Green PCR master mix (Applied Biosystems) and a Quant Studio 5 real-time PCR machine (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The precipitated nucleic acid was washed twice with 75% ethanol and resuspended in nuclease free water before being quantified on a Nanodrop (Thermo Scientific). Approximately 2 µg of AbmR-extracted nucleic acid ...
-
bioRxiv - Molecular Biology 2021Quote: ... The total yield of circular DNA was dissolved in DNase-RNase free water and then determined the concentration by Qubit fluorometer (Invitrogen, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... synthetic EMCV RNA variants (Table 5) were dissolved in distilled water and labelled at the 5’ end with Dylight 650 maleimide conjugates (Thermo Scientific) using the 5′ EndTag kit (Vector Labs ...
-
bioRxiv - Molecular Biology 2020Quote: ... Waters) configured with a 180 µm × 2 cm trap column coupled to a Q-Exactive Plus mass spectrometer (Thermo Fisher Scientific). A proxeon nanoelectrospray source set at 1800 V and a 75 µm (with 10 µm orifice ...
-
bioRxiv - Molecular Biology 2020Quote: ... High pH reversed fractionation was achieved by attaching a XBridge Peptide BEH C18 column (Cat. 186003570; Waters Corp.) to an Accela liquid chromatography system (Thermo Scientific) using the HPLC application ...
-
bioRxiv - Molecular Biology 2020Quote: ... or a reversed-phase C18 Sep-Pak cartridge (Cat. WAT023590; Waters Corp.) containing an oligo R3 reversed-phase resin (Cat. 1133903; Applied Biosystems) depending on protein quantity ...
-
bioRxiv - Molecular Biology 2020Quote: ... The dried peptides were resuspended in 0.1% FA and 3% ACN in water and protein quantity measured at A280 via NanoDrop (Thermo Fisher Scientific). Concentrations were normalized across all fractions and iRT (Biognosys ...
-
bioRxiv - Cell Biology 2022Quote: ... was resuspended in UltraPure DNase/RNase-Free Distilled Water and transfected into cells using Lipofectamine 2000 reagent (Thermo Fisher Scientific, 11668030) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... The magnetic beads were then washed once with 1× SSC and twice with 0.1× SSC and 50 μL of water was added along with 1 U of SUPERase In (Thermo Fisher, AM2694). Beads were treated with 2 U of Turbo DNase at 37°C overnight and the digestion was stopped with the addition of 1 μL of 10% SDS followed by purification with RNA clean XP purification beads (Bechman Coulter ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was diluted 20-fold in PCR-grade water and subjected to real-time quantitative PCR (qPCR) using SYBR Green PCR Master Mix (ThermoFisher 4309155) with gene specific ...
-
bioRxiv - Cancer Biology 2020Quote: Desalted peptides were dissolved in 3% acetonitrile/0.1% formic acid and were injected onto a C18 capillary column on a nano ACQUITY UPLC system (Waters) that was coupled to the Q Exactive plus mass spectrometer (Thermo Scientific). Peptides were eluted with a non-linear 200 minute gradient of 2-35% buffer B (0.1% (v/v ...
-
bioRxiv - Systems Biology 2020Quote: ... by a NanoAcquity UHPLC (Waters, Milford, MA) and monitored on a Q-Exactive Plus mass spectrometer (ThermoFisher Scientific, San Jose, CA). Elution was performed over a 120 minute gradient at a rate of 400 nL/min with buffer B ranging from 3% to 80% (buffer A ...
-
bioRxiv - Cancer Biology 2020Quote: ... NanoLC-MS/MS analyses were performed on a nanoACQUITY Ultra-Performance LC system (Waters, Milford, MA) coupled to a Q-Exactive Plus Orbitrap mass spectrometer (ThermoFisher Scientific) equipped with a nanoelectrospray ion source ...
-
bioRxiv - Synthetic Biology 2020Quote: ... with a total volume of 250 nL, added to 250 nL L2-MM (100 nL water, 10x Tango Buffer (Thermo Fisher): 50 nL ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA was ethanol precipitated and buffer exchanged to fresh DEPC-treated water using a Zeba Spin desalting column (Thermo Fisher Scientific) to remove the unreacted dye ...
-
bioRxiv - Genomics 2020Quote: ... Beads were subsequently incubated for 45 minutes at 37°C and 1100 rpm in Exonuclease I mix (170 μl nuclease free water, 20 μl 10x Exonuclease I buffer, 10 μl Exonuclease I - Life Technologies). Beads were then washed once in TE-SDS buffer ...
-
bioRxiv - Immunology 2021Quote: ... blots were washed in deionized water and probed using the iBind Flex system according to the manufacturer’s protocol (Invitrogen, Thermo-Fisher). Rabbit anti-SARS-CoV-2 spike (Sino Biological Inc ...
-
bioRxiv - Cell Biology 2020Quote: ... Peptide mixtures were analyzed by liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) using Nano-Acquity (Waters Corporation) UPLC system and LTQ-FT-Orbitrap (Thermo Scientific) mass spectrometer ...
-
bioRxiv - Neuroscience 2020Quote: ... the protein was dissolved in water before subjecting to on-line pepsin digestion using an immobilized pepsin cartridge (Applied Biosystems, USA). The eluted peptides were collected using a peptide trap column and eluted further from the column using an acetonitrile gradient ...
-
bioRxiv - Bioengineering 2020Quote: ... The product was then dialyzed against water using a Slide-A-Lyzer G2 10 kDa molecular cutoff dialysis cassette (Thermo Scientific) with daily water changes for 1 week ...
-
bioRxiv - Systems Biology 2021Quote: ... Data acquisition was operated on a NanoAquity 2D nanoLC (Waters) directly coupled in-line with a linear trap quadrupole (LTQ)-Orbitrap Velos instrument (Thermo Scientific) via Thermo nanoelectrospray source ...
-
bioRxiv - Biochemistry 2021Quote: ... B: 80% acetonitrile/0.1% formic acid in water on a 50 cm Acclaim PepMap RSLC C18 column (Thermo Fisher Scientific #164942) operated by a Dionex ultimate 3000 RSLC nano pump with column heating at 50°C connected to an Orbitrap Fusion Lumos ...
-
bioRxiv - Biochemistry 2020Quote: The samples were analyzed using an HPLC-ESI-MS/MS system consisting of a high performance liquid chromatograph (nanoAcquity, Waters) set in line with an electrospray ionization (ESI) Orbitrap mass spectrometer (LTQ Velos, ThermoFisher Scientific). A 100 μm id X 365 μm od fused silica capillary micro-column packed with 20 cm of 1.7 μm-diameter ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... 50 μl of the re-suspended sample were diluted 1:5 with LC MS-grade water and analyzed using a Dionex ion chromatography system (ICS 5000, Thermo Scientific). The applied protocol was adopted from 72 ...
-
bioRxiv - Neuroscience 2021Quote: ... Total protein (1 µl of samples were diluted to 100 µl with water) was estimated using microBCA assay according to the manufacturer instructions (Cat. No. 23235, Thermo Fisher). 300 µg of brain lysates (in 200 µl ...
-
bioRxiv - Neuroscience 2021Quote: ... 20 μg/ml in sterile water Gibco 10977035, 1 hour at 37°C followed by 3 washes with PBS Gibco 10010015) / Laminin (Gibco 23017-015 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA was resuspended in water and quantified with Qubit dsDNA BR Assay kit on Qubit 2.0 Fluorometer (Thermo Fisher Scientific). DNA integrity was assessed with Genomic DNA ScreenTape on TapeStation system (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... B: 80% acetonitrile/0.1% formic acid in water on a 50 cm Acclaim PepMap RSLC C18 column (Thermo Fisher Scientific #164942) operated by a Dionex ultimate 3000 RSLC nano pump with column heating at 50°C connected to an Orbitrap Fusion Lumos ...
-
bioRxiv - Cancer Biology 2020Quote: ... The eluted polyA+ RNA was ethanol precipitated and resuspended in 10μL of DEPC treated water with 1:20 SuperaseIN (Life Technologies, USA). Double-stranded cDNA was synthesized from the purified polyA+ RNA using the Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Neuroscience 2020Quote: ... The RNA was eluted in nuclease-free water and RNA concentration and quality was measured on a Nanodrop ND-1000 (Thermo Scientific). All RNA samples had a 260/280 ratio above 1.9 ...
-
bioRxiv - Biochemistry 2021Quote: ... using solvent A (0.1% formic acid in water) and separated on a C18 PepMap RSLC column (2 cm, 100 A; Thermo Fisher Scientific) using a linear gradient from 7 to 30% of solvent B (0.1% formic acid in acetonitrile ...
-
bioRxiv - Bioengineering 2021Quote: ... The supernatant was diluted 1:1 with PBS and dialyzed against deionized water across a 10 kDa molecular weight cutoff (ThermoFisher, 66830) for at least 3 days at a temperature of 50°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were rinsed in distilled water prior to mounting on slide with ProLong Diamond Antifade Mountant with DAPI (Molecular Probes P36962).
-
bioRxiv - Cell Biology 2021Quote: ... The isolated RNA was dissolved in 12 mkL of distilled RNAse-free water and reverse transcribed using miRCat-33 primer (IDT) with Superscript III Reverse Transcriptase (Life Technologies) in its buffer for 1h at 50°C ...