Labshake search
Citations for Thermo Fisher :
2801 - 2850 of 10000+ citations for Killer cell immunoglobulin like receptor 2DL3 KIR2DL3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Immortalized human retinal pigment epithelial cells (RPE-1hTERT, ATCC) were cultured in Dulbecco’s modified Eagle’s medium (Gibco/Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: Human embryonic kidney (HEK) 293T and Vero cells were grown in Dulbecco’s modified Eagle medium (DMEM) (Gibco) supplemented with 10 % fetal bovine serum (FBS ...
-
bioRxiv - Biophysics 2024Quote: Human mesenchymal stem cells (hMSCs) (ATCC, lgc-standards, Teddington, UK) were cultured in high-glucose DMEM (Gibco) supplemented with 10% FBS and 1 % penicillin/streptomycin ...
-
bioRxiv - Cell Biology 2024Quote: Human A549 lung carcinoma cells (ATCC, CCL-185) were maintained in Gibco DMEM/F-12 (Thermofisher 11320033) with 100 U/ml penicillin ...
-
bioRxiv - Biochemistry 2024Quote: The human derived NCH612 glioma cell media was prepared using 500 mL DMEM: F12/Glutamax media (Gibco) with the following additives ...
-
bioRxiv - Biochemistry 2024Quote: Synchronized or treated human embryonic kidney (HEK293T) cells were lysed in RIPA buffer (Thermo Fisher Scientific # 89901) containing 10mM of sodium butyrate ...
-
bioRxiv - Biophysics 2024Quote: Human-derived neuroblastoma cells (SH-SY5Y, ATCC Product Number: CRL-2266) were cultured in DMEM-F12 (Invitrogen) medium supplemented with 10 % (v/v ...
-
bioRxiv - Immunology 2024Quote: ... Primary human CD8+ T cells were left unstimulated or were stimulated with anti-CD3/CD28 dynabeads (ThermoFisher) at a 1:1 bead-to-cell ratio for 6 ...
-
bioRxiv - Neuroscience 2024Quote: ... Human primary Müller cells (P3) at 80% confluency were transfected with MT1 (assay ID: s194623, ThermoFisher Scientific), AKAP12 (assay ID ...
-
bioRxiv - Genetics 2024Quote: Human embryonic kidney (HEK) 293T cells were maintained in DMEM supplemented with 10% fetal calf serum (Gibco). Cells were seeded with 300 000 cells/well in 6-well plates and transfected 24 hours later with 1 µg of each minigene construct mixed with 3 µL of Lipofectamine 2000 Reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... h-iECs were dissociated into single cells and sorted into CD31+ and CD31-cells using magnetic beads coated with anti-human CD31 antibodies (DynaBeads, ThermoFisher, Cat No. 11155D). The purified CD31+ h-iECs were then expanded in culture on 10-cm dishes coated with 1% gelatin ...
-
bioRxiv - Immunology 2021Quote: ... at the concentration 1×106 cells per ml for TNF-α assessment in myeloid cells or Dynabeads Human T-Activator CD3/CD28 (ratio 1:2, Thermo Fisher Scientific) for IFN-γ assessment in T-cells in the presence of protein transport inhibitor (BD GolgiStop™ ...
-
bioRxiv - Cancer Biology 2020Quote: ... B lymphocytes were obtained by negative cell selection using the MagniSort Human B-cell enrichment kit II (Thermo Fisher Scientific, Carlsbad, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... human NSCLC cell lines and HARA human lung squamous carcinoma cell line were maintained in RPMI-1640 supplemented with 10% FBS (Gibco BRL, Gaithersburg, MD). Cell transfection was carried out by Lipofectamine 2000TM (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... and after 24h of incubation fresh medium was added and cells were transfected with 100ng of total RNAs from cell cultures or human tissues using Lipofectamine 2000® (11668-019, Thermo Fisher Scientific). As positive controls ...
-
bioRxiv - Cell Biology 2024Quote: ... 2002) cells and human immortalized endometrial cells (T-hESC) (ATCC, CRL-4003) were cultured in DMEM/F-12 (Invitrogen, Grand Island, NY, USA) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... The human nasal septum epithelial cell line RPMI 2650 (ATCC CCL-30) cells was cultured in Advanced MEM culture medium (Gibco™ 12492-013) supplemented with 2.5% FCS and 4 mM L-glutamine ...
-
bioRxiv - Molecular Biology 2023Quote: A total of 3×105 CD45Δ T cells (from 2 healthy donors) and T cells (from 2 healthy donors) (effector cells) were mixed with Dynabeads Human T Activator CD3/CD28 (Thermo Fisher Scientific, USA) on the 8th-16th days after knockout of CD45 (E:beads ratio was 1:1 ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Cot-1 DNA (Invitrogen), 3M NaAc and 100% cold EtOH ...
-
bioRxiv - Cancer Biology 2024Quote: Recombinant human EGF (Gibco #PHG0311) was added to the medium of NCI-H23 or H23 KO cells at 80% confluency to reach a final concentration of 100 ng/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Pool Set v3.0 (Thermofisher) and TaqMan™ MicroRNA Reverse Transcription Kit (Thermofisher) ...