Labshake search
Citations for Thermo Fisher :
2651 - 2700 of 10000+ citations for Progesterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: DNA in 100 µl of undiluted cell-free BALF (first wash) was quantified in DNase-free 96-well plates (TPP®) using Quant-iTTM Pico GreenTM dsDNA Assay Kit (Thermo Fisher Scientific) following manufacturers’ instructions.
-
bioRxiv - Zoology 2019Quote: Ten microliters of PCR amplicon was purified and normalized for concentration prior to library preparation using SequalPrep Normalization Plate Kit (Thermo Fisher Scientific, USA). DNA libraries were prepared using the NEBNext Ultra DNA Library Prep Kit for Illumina (New England BioLabs ...
-
bioRxiv - Genomics 2022Quote: ... and split half for maintenance in a well of a 96-well plate and half used for genotyping using the Phire Animal Tissue Direct PCR Kit (Thermo Fisher Scientific, F140WH) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 µL of each concentration was transferred into a U-shaped 96-well plate and incubated with 100 µL QuantaBlu™ Fluorogenic Peroxidase Substrate Kit (Thermo Scientific™) for 40 minutes along with the sEV samples to be detected on O-NEXOS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... for final quality assurance the CFFT Lab subjected all its plasmids from the daughter plate to next generation sequencing (NGS): DNA from plasmid constructs was quantitated using Qubit dsDNA HS Assay Kit (Q33230, Thermo Fisher Scientific, USA) as per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 9 µL of the dPCR reaction mix was added to each well of a QuantStudio Absolute Q MAP16 Plate Kit (PN A52865, ThermoFisher Scientific, Waltham, MA). Next ...
-
bioRxiv - Neuroscience 2024Quote: ... Raw cytokine values per well were normalized over nuclei number per well based on fluorescent staining of the fixed iAstrocytes in the plate or over protein content per well determined by Pierce™ BCA protein assay kit (Thermo Scientific, 23225). Pierce™ BCA protein assay was performed in a microplate as described in the user guide provided by Thermo Scientific.
-
bioRxiv - Cell Biology 2024Quote: ... was used to measure collagen in lung lobes following kit instructions and optical density was measured using a Varioskan LUX plate reader (Thermo Fisher Scientific, VL0000D0).
-
bioRxiv - Immunology 2020Quote: ... BRET signal was read after 5 min of coelenterazine-h (5 μM, Invitrogen) addition ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 52h after plating 5 µM 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was added for 20 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Then 5 μg/ml Hoechst 33342 and 5 µM CellRox Deep Red (Invitrogen) and/or MitoSox Red (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: - Falcon round-bottom polystyrene tubes 5 mL (Cat# 14-959-5, Fisher Scientific)
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Microbiology 2023Quote: ... 5-fluorocytosine (100 mg/kg/d; diluted in sterile saline; 5-FC; ThermoFisher) was used in combination with PEA (0.5 mg/kg/d ...
-
bioRxiv - Immunology 2023Quote: ... 5x10-5 M 2-mercaptoethanol (2-ME) and 5 mM HEPES (all Invitrogen).
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 5% fetal calf serum and 5% newborn calf serum (both GIBCO) and antibiotics (#A5955 ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 5% fetal calf serum and 5% newborn calf serum (both GIBCO), and antibiotics (#A5955 ...
-
bioRxiv - Microbiology 2024Quote: ... 0.6 μL of 5 μM TaqMan probe (5’-FAM-CAAGAGGTGGACGGCC-MGB) (ThermoFisher Scientific) and 0.1 μL of nuclease free water ...
-
bioRxiv - Microbiology 2022Quote: ... The F gene was PCR amplified using primers RSV F 5’ (5’GCAAGGATTCCTTCGTGAC3’) and RSV F 3’ (5’CACACCACGCCAGTAG3’) and Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Sanger sequencing was performed by Elim Biosciences.
-
bioRxiv - Molecular Biology 2022Quote: ... pLV-mCherry at ratio 1:1:1 (i.e. 5:5:5 μg) using Lipofectamin™ 3000 transfection reagent (Thermo-Fisher Scientific, #L3000015). Pseudoviruses harvested from the supernatant at 48 h 72h post-transfection were filtered (0.44 μm ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... one lung section 5×5×5 mm in size was finely cut and stored at -20°C in RNAlater (Thermo Scientific, US). We mechanically disrupted the tissue from RNAlater using a MediMachine (BD Biosciences ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was subjected to 5’ adapter ligation with a 5’ chimeric DNA-RNA adapter (5’aminolinker-GTTCAGAGTTCTACAGTCCGACGATCrNrNrNrN) using RNA ligase (EL0021, Thermo Fisher Scientific) at 37°C for 1 hour ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cell Biology 2023Quote: ... Leukocytes were washed with cold PBS followed by another centrifugation step (300 x g 5 minutes) and resuspended in 5 mL of 5 μg mL-1 of Hoechst 33342 (Thermo Fisher Scientific) diluted in warm PBS ...
-
bioRxiv - Biophysics 2020Quote: ... 30,000 cells were seeded into a 24-well plate (NuncMicroWell Plates with Nunclon; Thermo Fisher Scientific, Waltham, MA). Transfection was carried out at day 1 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Ninety-six-deep well plates and 500 cm2 cell culture plates were purchased from Fisher Scientific (Loughborough, UK). Millipore 96-well GF/B filter plates were purchased from Receptor Technologies (Warwick ...
-
bioRxiv - Microbiology 2020Quote: ... and vancomycin in Mueller-Hinton broth using sensititre plates EUVENC Sensititre® plates (Thermo Fisher Scientific, Waltham, USA) and home-made 96-well microtiter plates for levofloxacin following the CLSI guidelines (19).
-
bioRxiv - Immunology 2021Quote: ... to each well and the plates read at 450 nm using a Multiscan FC Plate Reader (Thermo Scientific). ELISA results were presented as normalised OD450 with the mean OD450 values of blank wells subtracted from the sample well values.
-
bioRxiv - Cell Biology 2023Quote: ... 800,000 cells were seeded into a 6-well plate (NuncMicroWell Plates with Nunclon; ThermoFisher Scientific, Waltham, MA, USA). At day 0 the transfection was done ...
-
bioRxiv - Microbiology 2023Quote: ... and 20 µl of the samples were distributed into 96-well plates (V-bottom storage plates, Thermo Scientific). Additionally ...
-
bioRxiv - Microbiology 2023Quote: ... cells and supernatants or of mGAM were distributed into 96-well plates (V-bottom storage plates, Thermo Scientific) according to drug-treatment concentration ...
-
bioRxiv - Immunology 2024Quote: ... Ninety-six well polystyrene plates NUNC MaxiSorp™ or NUNC 384-Well Clear polystyrene plates (Thermo Fisher Scientific) were coated with 2,4-dinitrophenyl conjugated to BSA (DNP-BSA ...
-
bioRxiv - Cell Biology 2020Quote: Proliferation was assessed through incorporation of 5-ethynyl-2’-deoxyuridine (EdU) using the Click-iT EdU Alexa Fluor 488 Flow Cytometry Assay Kit (Invitrogen, C10425). One day prior to harvest ...
-
bioRxiv - Genetics 2021Quote: ... The membrane was hybridized with a biotin-conjugated telomere probe (5’-biotin-CACACCCACACCCACACC-3’) and was imaged using a Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Scientific) and a Li-Cor C-DiGit Chemiluminescent Western Blot scanner.
-
bioRxiv - Genetics 2020Quote: ... cDNA was synthesised from 5 µg RNA using random hexamer primers and the RevertAid H Minus First Strand cDNA Synthesis kit (Thermo Scientific).
-
bioRxiv - Developmental Biology 2020Quote: ... Each primer contains a T7 sequence at its 5’ end for use with the MEGAshortscript T7 transcription kit (Thermo Fisher Scientific). The reaction was placed in boiling water and allowed to cool to room temperature to promote annealing ...
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA oligo template (5’ TAATACGACTCACTATAGGGACACAAAACAAAAGACAAAAACACAAAACAAAAGACAAAAACA CAAAACAAAAGACAAAAAGCCTCTCCTTCTCTCTGCTTCTCTCTCGCTGTGTGCGTACAACTAGCT 3’) was PCR-amplified and then in vitro transcribed using the MEGAshortscript™ T7 Transcription kit (Invitrogen). An 11:7 ratio of the helicase RNA substrate to 5’ Alex Fluor 488 fluorescent oligo strand (Alexa Fluor 488/ AGCTAGTTGTACGCACAC ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was isolated from WT and MafAS64F/+ islets (n=4 for males, n=5 for females) using the RNAqueous total RNA isolation kit (Ambion; Thermo Fisher), and then analyzed on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Bioengineering 2022Quote: Primary neonatal cardiomyocytes were isolated from C57BL/6 mouse neonates on postnatal days 3-5 using the Pierce Primary Cardiomyocyte Isolation Kit (Thermo Fisher) as previously described (14) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5-ethynyl-2′-deoxyuridine (EdU) incorporation was detected using a Click-iT Plus EdU Alexa Fluor 555 Assay Kit (Invitrogen, C10638) prior to primary antibody incubation ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the reverse transcription of 5 μL of extracts was carried out using the TaqMan™ MicroRNA Reverse Transcription Kit (ThermoFisher, USA) including the TaqMan RT 5 x primer (assay ID ...
-
bioRxiv - Neuroscience 2019Quote: The study of proliferation and differentiation of neural stem cells in the dentate gyrus was performed by incorporation of 5-ethynyl-2’-deoxyuridine (EdU, Click-iT EdU Imaging Kit; Molecular Probes) to allow the analysis of proliferation and differentiation ...
-
bioRxiv - Genomics 2019Quote: ... After dissociation of bead-bound RNA by heating (70°C, 5 min) cDNA synthesis was carried out using the Superscript VILO cDNA Synthesis kit (Invitrogen, 11754). RNA/cDNA hybrids were then incubated for 5 min at 85°C and quantification was carried out by qPCR with specific primer pairs (Fig ...
-
bioRxiv - Immunology 2019Quote: ... LDH assay was performed 16 hours after infection using 5·104 cells following manufacturer instructions (Pierce LDH Cytotoxicity Assay Kit, ThermoFisher Scientific).
-
bioRxiv - Cancer Biology 2019Quote: We performed chromatin immunoprecipitation (ChIP) on 4-5×106 MDA-LM2 or SUM-LM1 cells using the PierceTM Magnetic ChIP Kit (ThermoFisher Scientific) according to manufacturer’s instructions with 10 μg rabbit IgG isotype control or c-Jun antibody (Cell Signaling) ...