Labshake search
Citations for Thermo Fisher :
2601 - 2650 of 10000+ citations for Progesterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 5% horse serum (Invitrogen) and 0.3% Triton X-100 (Sigma ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM DTT (Invitrogen), 1 M betaine (Sigma) ...
-
bioRxiv - Physiology 2023Quote: ... 5 mM MgCl2 (Invitrogen), 10 mM Tris buffer pH 8.0 (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... The RT-PCR reactions were performed by ABI QuantStudio 5 (Applied Biosystems) using 5 µL of PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% B27 supplement (Gibco) and 5% Fetal Bovine Serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM EDTA (ThermoFisher), 1% nonidet P-40 (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... DTT (5 mM, Invitrogen), RNaseOUT (40 U ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM dithiothreitol (Invitrogen), 500 nM FSE primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the plate was then read at 450 nm using a Multiskan® EX plate reader (Thermo Scientific), and the data analysed in GraphPad Prism version 7.0c ...
-
bioRxiv - Bioengineering 2021Quote: ... Fluorescence readings were conducted using a Spectramax plate reader in a black-walled clear bottom plate (Nunc), with the excitation/emission for TO1 and TO3 being 510/535 nm and 637/658 nm ...
-
bioRxiv - Microbiology 2021Quote: ... pneumoniae (one colony per species per plate) were further sub-cultured on Sheep Blood Agar plates (ThermoFisher) and species identity confirmed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS ...
-
bioRxiv - Neuroscience 2021Quote: ... the plate was washed 4 times with PBST using a plate washer (Thermo Fisher Scientific Wellwash Versa), and anti-pTRKB antibody (1:1000 in the blocking buffer ...
-
bioRxiv - Plant Biology 2023Quote: Stratified seeds were germinated on square plates (100 mm × 100 mm square plates; Fisher Scientific; Cat#FB0875711A) containing sterile full-strength (1x ...
-
bioRxiv - Biochemistry 2024Quote: ... if a 96-well plate (SureSTARTTM WebSealTM 96-Well Microtiter Plate, SN: 60180-P210B, Thermo Fisher Scientific) was used for injection ...
-
bioRxiv - Microbiology 2023Quote: ... the plate was transferred to 20° C pre-cooled plate reader (Multiskan GO, Thermo scientific, Waltham, MA) and shaken slowly for 10 seconds ...
-
bioRxiv - Biophysics 2023Quote: 6-well plate cell proliferation – Cells were seeded into 6-well plates (Fisher Scientific, 07-200-83) 150,000 cells/well and left at ambient temperature for 20 minutes to ensure homogeneous settling ...
-
bioRxiv - Biochemistry 2019Quote: ... 5’-GMPS-pre-tRNAAsp was prepared by in vitro transcription in the presence of guanosine 5’-monothiophosphate (GMPS) and labeled by reaction with 5-iodoacetamido-fluorescein (5-IAF, Life Technologies) overnight at 37 °C to prepare Fl-pre-tRNA (37,38) ...
-
bioRxiv - Microbiology 2019Quote: ... falciparum strain 3D7 parasites were grown under 5% O2 and 5% CO2 in RPMI-1640 media supplemented with 5 g/L Albumax II (Life Technologies), 2 g/L sodium bicarbonate ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by sonication three times for 5 seconds with 5 seconds intervals at #5 (on dial) (Fisher Scientific 60 Sonic Dismembrator) on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Evolutionary Biology 2022Quote: The purified RNA was used to amplify cDNA from the gUTRGFP template with the 5’ Cy-5 labelled pWP252fluor primer (5’ ATAACGGACTAGCCTTA 3’) using the standard Superscript III First-Strand Synthesis System (Thermo Fisher) with 3 µg of total RNA and elongating at 52.5°C for 60 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were cultured at 37 °C in a humidified incubator at 21% oxygen/5% CO2 or 5% O2/5% CO2 (HeraCell Tri-Gas, ThermoFisher Inc).
-
bioRxiv - Neuroscience 2020Quote: ... Human phospho-tau [pT181] was measured using a commercially available ELISA per manufacturer’s instructions (Thermo Fisher Scientific, KHO0631). Guanidine extracted supernatants of hippocampus homogenates described above were utilized for the pTau ELISA.
-
bioRxiv - Neuroscience 2020Quote: The level of Aβ in the tissue was assessed by ELISA as per the manufacturer’s instructions (KHB3442, Invitrogen). The resulting measurements were normalized for tissue weight.
-
bioRxiv - Neuroscience 2021Quote: ... were prepared for ELISAs by coating each well with 50ul of 1.5ug/ml HT7 monoclonal antibody (Thermo Fisher) the night before use ...
-
bioRxiv - Neuroscience 2020Quote: ... whole brain lysates were prepared as for ELISA and protein concentration determined using a BCA assay (Thermo Fisher). Wells were loaded with 30 µg of total protein which was resolved by SDS-PAGE under reducing conditions and transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Neuroscience 2019Quote: ... and results of the ELISA were measured by a colorimetric microplate reader (VarioSkan 2.2; Thermo Scientific Inc., USA) at 450nm ...
-
bioRxiv - Pathology 2021Quote: ... After staining with 1-Step™ Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific, San Jose, CA, US), mean absorbances in duplicates were read at 450nm and ratio of HAA/PNA was calculated for each sample in order to measure changes of glycosylation ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were pelleted (400xg, 10 min) and supernatants subjected to ELISA analysis for IL-17a (Thermo Fisher, UK).
-
bioRxiv - Immunology 2022Quote: ... Human IFNg and IL-13 cytokine secretion was measured by ELISA using eBioscience Ready-SET-Go! (now ThermoFisher) ELISA kits according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... CRP and IL-6 were measured in UCB plasma using a high-sensitivity ELISA (Life Technologies, Carlsbad CA) per the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... and the assay was developed with 1-Step™ Ultra TMB-ELISA Substrate Solution (Thermo Fisher, Cat#34029) and blocked with 2N H2S04 solution before reading ...
-
bioRxiv - Immunology 2022Quote: ... 200 ng/ml) and medium was collected for analysis of the amount of secreted TNFα by ELISA (Invitrogen).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The concentration of Aß40 and Aß42 in the culture medium was quantified by ELISA (Thermo Scientific, Waltham, MA). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... supernatants were collected for cytokine analysis by ELISA (IL-2 BD-OptEIA™; IL-17A, IFN-γ ThermoFisher) following manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... supernatants were collected and cytokines quantified by ELISA according to manufacturers’ instructions (R&D Systems, Biolegend of Invitrogen), except antibody and sample volumes were halved.
-
bioRxiv - Neuroscience 2024Quote: ... The concentrations of human α-synuclein were measured using a human α-syn-specific ELISA (ThermoFisher Scientific #KHB0061) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... the substrate of the peroxidase (100µL, 3,3’,5,5’-tetramentylbenzidine solution; 1-StepTM Ultra TMB-ELISA, 34029, Thermo Scientific) was added in each well for 10 to 25 minutes at RT and in darkness ...
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Cancer Biology 2023Quote: ... 50 μg protein per sample was used to perform mouse Granzyme B Platinum ELISA (Thermo Fisher Scientific #BMS6029) and the protocol was followed as per the product manual.
-
bioRxiv - Cell Biology 2023Quote: ... Concentrations of IL33 and periostin in culture supernatants were measured by ELISA according to the manufacturer’s instructions (Invitrogen, cat # ...
-
bioRxiv - Cell Biology 2023Quote: ... antibody concentration (ng/ml) in collected media was determined with Total Mouse IgG enzyme-linked immunoassay (ELISA, Invitrogen) and extrapolated from generated standard curves ...
-
bioRxiv - Plant Biology 2020Quote: ... The amplicons were checked by electrophoresis and 25 µl of each pooled PCR product were purified and normalized using SequalPrep Normalization Plate Kit (Invitrogen GmbH, Karlsruhe, Germany). We then pooled the samples and the mock community and proceeded for a single library preparation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sequencing reactions were carried out on 96-well plates using BigDye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (Applied Biosystems, foster City, CA) for 30 cycles ...
-
bioRxiv - Biochemistry 2020Quote: Total RNA was extracted from 10-day old seedlings grown on ½ MS plates under long-day conditions using PureLink RNA Mini Kit (Thermo Fisher Scientific, 12183025). One microgram of total RNA was reverse transcribed into cDNA with Protoscript II (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... as described in Caporaso et al.[24] PCR products were cleaned and normalized using the SequalPrepTM Normalization Plate Kit (Cat. No. A1051001, ThermoFisher, Waltham, MA, USA) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was produced from mRNA from cells lysed directly in the culture plate using the TaqMan® Gene Expression Cells-to-CT™ Kit (ThermoFisher Scientific). qRT-PCR was then carried out using the corresponding TaqMan™ Gene Expression Assay Kit that include exonspanning probes for genes of interest (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... The plates were incubated at 37°C for 24 hr and stained with a Filmtracer LIVE/DEAD Biofilm Viability Kit (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... skin homogenate or 100 µl of insect homogenate was extracted in a 96-well plate with the MagMAX™ CORE Nucleic Acid Purification Kit (Applied Biosystems, A32700) using protocol A in a KingFisher™ Flex Magnetic Particle Processor (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: 10 μL of PCR product for each sample was normalized using a SequalPrep 96-well Normalization Plate Kit (Thermo Fisher Scientific, Waltham, MA). Samples were eluted in 20 μL of elution buffer and 10 μL of each sample was pooled and concentrated to 20 μL using 0.7x AMPureXP beads (Beckman Coulter ...