Labshake search
Citations for Thermo Fisher :
2501 - 2550 of 10000+ citations for 6 Benzothiazolamine 2 1 methylpropyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... HEPES ((4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)) was obtained from Fisher Scientific (Pittsburg, PA). Peptides were reconstituted at 25 mg ml-1 in nuclease-free ultra pure water as per the manufacturer’s instructions and stored as aliquots at -20°.HP1α was reconstituted (0.5 mg ml-1 ...
-
bioRxiv - Neuroscience 2024Quote: ... 2) Concentrate worms by centrifugation (1 minute, 4000-RPM, Thermo Scientific Sorvall Legend X1R), discard the supernatant ...
-
bioRxiv - Microbiology 2023Quote: ... Mouse anti-E-cadherin (2 μg/ml, clone HECD-1; Invitrogen, Carlsbad, California, USA) and mouse anti-CX3CL1 (2 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... 1.5 mL of enhancer 1 and 0.15 mL of enhancer 2 (Expifectamine kit, Gibco) were added to the cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... and AF647 rat anti-Intercellular adhesion molecule 2 (ICAM2, 1:250, A15452, Thermo Fisher).
-
bioRxiv - Microbiology 2023Quote: ... 1-2 ug of RNA was converted to cDNA using reverse transcriptase (Applied Biosystems).
-
bioRxiv - Immunology 2023Quote: ... Luc-Screen™ Extended-Glow Luciferase buffers 1 and 2 (ThermoFisher, Cat No. T1035) used according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1-2 drops of ProLong Gold Antifade Mountant (cat# P36930, Molecular Probes, Eugene, OR) were added ...
-
bioRxiv - Cell Biology 2023Quote: ... at 1:1000 dilution in 2× SSC (diluted from 20× SSC, Invitrogen, 15557-044) for 10 min ...
-
bioRxiv - Cell Biology 2023Quote: ... After blocking for 1 hour in 2% bovine serum albumin (BSA; BP9701, Fisher Scientific) in PBS ...
-
bioRxiv - Immunology 2023Quote: The Caco-2/THP-1 co-cultures were washed thrice with DPBS (Gibco, #10010023) to remove any residual substances ...
-
bioRxiv - Developmental Biology 2023Quote: ... The LSC growth medium contains 2:1 Dulbecco’s Modified Eagle Medium (Life Technologies, 21969035) and F12 (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... filtered through a slow filter paper (#293; 1–2 µm Sartorius, Thermo Fisher Scientific), and then used to determine electrical conductivity (EC) ...
-
bioRxiv - Immunology 2023Quote: ... and an ICAM1 exon 2 (Ig domain 1)-targeting TrueGuide sgRNA (Invitrogen; sequence: CCACAGTTCTCAAAGCACAG) according to the manufacturer’s U2OS protocol ...
-
bioRxiv - Immunology 2023Quote: ... Lymphocytes were plated at 1-2 × 106 cells/mL in RPMI: RPMI 1640 (Gibco) supplemented with 15% FCS ...
-
bioRxiv - Biophysics 2023Quote: ... 1 mM TCEP (tris(2-carboxyethyl)phosphine (TCEP) and EDTA-free protease inhibitors (ThermoFisher). Cells were lysed by sonication and the cell debris pelleted at 50000 x g and 4 °C for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µL 1 M DTT and 27.5 µL of T4 Polynucleotide Kinase (Thermo Scientific) were added to the annealed oligonucleotides and the reaction was incubated for 2 h at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The microwells were in lysis buffer (1% 2-mercaptoethanol (Fisher Scientific, cat# BP176-100), 99% Buffer TCL (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... viruses were mixed 1:2 with PBS-washed sheep blood (Fisher Scientific, MA, USA) supplemented with 5 mM ATP ...
-
bioRxiv - Physiology 2023Quote: Isolated cardiomyocytes were loaded with 1 μM Fura-2 AM (Invitrogen, Carlsbad, California, USA) at room temperature for 15 min and then washed for 15 additional min with an external Ringer solution containing (in mmol/L) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% of Horse Serum and 1% of penicillin-streptomycin (Thermo Fisher, Waltham MA, USA).
-
bioRxiv - Biochemistry 2023Quote: ... and 1% SDS buffer and digested with 2 µL RNAse Cocktail (Thermo Fisher, AM2286) for 4 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... PANC-1 and MIA PaCa-2 cell lines were cultured in DMEM medium (Gibco) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2 h and Alexa Fluor 594-conjugated streptavidin (1:500, Thermo Scientific, S32356) for 1 h at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... for 1 h at 4°C.The DynaMag™-2 magnetic rack (Thermo Fisher Scientific) was used for flow-through removal and washing ...
-
bioRxiv - Cell Biology 2024Quote: ... freshly diluted 1:500 in imaging media (Leibovitz’s L-15 [Gibco] with 2% FBS). 1 mL of differentiated HL-60 cells were spun down at 200x g for 3 min and resuspended in 500 µL of the labeling solution ...
-
bioRxiv - Developmental Biology 2024Quote: ... Alexa Fluor 647 rat anti-intercellular adhesion molecule 2 (ICAM2, 1:500, A15452, ThermoFisher), rat anti-MKI67 (KI67 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and ERCC RNA ExFold RNA Spike-In Mix 1 and 2 (Thermo Fisher Scientific) were added to wild-type and Meioc-null samples ...
-
bioRxiv - Developmental Biology 2024Quote: ... and then incubated in 1 mL crosslinking solution containing 2% formaldehyde (Pierce, ThermoFisher Scientific) (50mM HEPES Buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Caki-1 and Caki-2 cells were cultured in McCoy’s 5A modified medium (Gibco) supplemented with 10% FBS and 1% P/S ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were cultured with the 2:1 mixture of IMDM (Life technologies) and Ham’s-F12 nutrient mixture (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... Primary antibodies include Anti-beta tubulin (1:500, mouse monoclonal, 2 28 33, Invitrogen) and Anti-Hec1 (1:1000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... HET(1) and HET(2) hESCs was extracted using mirVana microRNA isolation kit (ThermoFisher). Small RNA libraries were generated using NEXTFlex Small RNA Library Prep Kit v3 (Cat #NOVA-5132–06 ...
-
bioRxiv - Biochemistry 2024Quote: ... containing 2% sodium dodecyl sulfate and 1 mM PMSF protease inhibitor (Thermo Fisher Scientific). Following a 30-minute incubation on ice with periodic vortexing ...
-
bioRxiv - Plant Biology 2022Quote: ... total soluble proteins were extracted from 50 mg of plant materials grown as indicated previously with 100 μL 2 x Laemmli buffer supplemented with 1% Phosphatase Inhibitor Cocktail 2 (Thermo Fisher Scientific Inc., 78430). Proteins were denatured for 10 min at 95°C and separated on 10% or 8% SDS-PAGE ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in 2-(N-(7-nitrobenz-2-oxa-1,3-diaxol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Invitrogen) (20 µM ...
-
bioRxiv - Physiology 2021Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in saline solution at 5 mg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (100 μM; ThermoFisher Scientific) with Hoechst (1 μg/mL ...
-
bioRxiv - Physiology 2019Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in PBS at 5 mg/ml ...
-
bioRxiv - Immunology 2020Quote: ... Glucose uptake assay was performed by incubating cells with 50 µM 2-NBDG (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose) (Invitrogen) for 90 min at 37°C prior to cell staining ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended in glucose-free media containing 150 μM 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG Thermofisher) and incubated for 45 minutes at 37°C.
-
bioRxiv - Microbiology 2020Quote: ... the sections were sequentially incubated with mouse polyclonal antibody to SARS-CoV-2 N protein (1:500 dilution) and HRP-conjugated goat anti-mouse IgG secondary antibody (1:5000 dilution, Invitrogen). The sections were observed under microscope (Olympus ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Regulatory T cells were activated at 1 x 106 cells mL-1 for 2 days in complete XVivo15 supplemented with magnetic Treg Xpander CTS Dynabeads (ThermoFisher) at a 1:1 bead to cell ratio and 500 U mL-1 of IL-2 (UCSF Pharmacy) ...
-
bioRxiv - Microbiology 2019Quote: ... A 2 μl volume of cDNA diluted 1:4 (IAV) or 1:5 (reovirus) in molecular biology grade water (Invitrogen) was added to the 384 well plate ...
-
bioRxiv - Neuroscience 2019Quote: ... KSR medium was gradually transitioned in 25% increments to neural medium (N2/B27-Neurobasal medium, 2% B27 supplement, 1% N2 supplement, 1% Glutamax, (ThermoFisher)) over an 11-day period ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells from the previous steps were barcoded by cotransfecting PB-EF1α-Puro-V8.2 library and Super PiggyBac Transposase plasmid (SBI #PB210PA-1) at a 1:10 molar ratio using Lipofectamine 3000 (Thermofisher). Barcoded cells were puromycin-selected for 7 d ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were then incubated for 1 hr with goat anti-rabbit Alexa Fluor 488F(ab’)2 Fragment (1:1000, A11070; Invitrogen) and Alexa Fluor 568 Phallodin (A12380 ...
-
bioRxiv - Microbiology 2021Quote: ... the sections were incubated with house-made mouse anti-SARS-CoV-2 nucleocapsid protein serum (1:5000) and HRP465 conjugated goat anti-mouse IgG secondary antibody (1:5000 dilution, Invitrogen). The lung sections from the vector-transduced mouse were used as negative control ...
-
bioRxiv - Microbiology 2021Quote: ... in 10% FBS for 1-2 hours followed by incubation with secondary goat anti-rabbit AlexaFluor 594 antibody (1:1000, Invitrogen) in 10% FBS for 30 min ...
-
bioRxiv - Bioengineering 2020Quote: ... The cells were passaged at a density of 1:2 to 1:8 after reaching ~80% confluency by detaching with 5 mM EDTA in PBS (Invitrogen 15575-038 diluted in sterile 1X PBS ...