Labshake search
Citations for Thermo Fisher :
201 - 250 of 5328 citations for Tryptase delta Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... B.1.617.2 (delta) and B.1.1.529 (Omicron)] and MERS-CoV spike using Lipofectamine 2000 (ThermoFisher Scientific cat.# 11668019) to produce single-round infection-competent pseudoviruses (80) ...
-
bioRxiv - Microbiology 2022Quote: ... They were subsequently analysed by EA-IRMS with FlashEA 1112 Series and a Delta V Plus (ThermoFisher Scientific), as previously described (8) ...
-
bioRxiv - Plant Biology 2022Quote: ... coupled to an isotope ratio mass spectrometer (delta V isotope ratio mass spectrometer, Thermo Fisher Scientific, Courtaboeuf, France) calibrated using international reference (caffeine ...
-
bioRxiv - Microbiology 2022Quote: ... The 18O enrichment of the DNA was measured using TC/EA-IRMS (Delta V Advantage, Thermo Fisher, Germany) at the UC Davis Stable Isotope Facility ...
-
bioRxiv - Plant Biology 2023Quote: ... coupled to an isotope ratio mass spectrometer (Thermo Finnigan Delta Plus XL; Thermo Fisher Scientific, Waltham, MA, USA). δ13Cair for each CO2 treatment was estimated by calculating the mean of the triplicate δ13Cair samples within each chamber ...
-
bioRxiv - Biochemistry 2024Quote: ... the cells (5×105 cells per well) were incubated in six-well plates (Thermo Fisher Scientific, Nunclon Delta) for 2 h before stimulation with 100 ng/mL lipopolysaccharide (from E ...
-
bioRxiv - Microbiology 2022Quote: ... The 15N and 14N ratios of N2 were detected by isotope ratio mass spectrometer (Delta V Advantage, ThermoFisher), and the δ15N values of the pending samples were calculated after comparing with the international standard (Atm-N2) ...
-
bioRxiv - Cell Biology 2023Quote: ... FIP5-mcherry expressing RCTE stable cells were cultured in delta TPG dish (12-071-33, ThermoFisher Scientific Inc.) with 0.5 ml 10% FBS containing medium ...
-
bioRxiv - Biophysics 2023Quote: ... Hydrogel-cell mixtures were crosslinked in NuclonTM Delta surface 96-well plates (Thermo Fisher, Carlsbad, California, United States) and cultured in chondrogenic media for 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... B6.Cas9 keratinocytes(see above) were plated in 6-well plate (Thermo Scientific Nunclon TM Delta Surface; 140675) at 1.5 × 105 cells per well and infected with 100-300μl of low-titer virus in the presence of infection mix (1/10 dilution of polybrene [10 mg ml−1 Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were cultured in a 96-well format (Nunclon™ Delta Surface, #136102; Thermo Fisher Scientific, Schwerte, Germany) at 12,000 cells/well overnight ...
-
bioRxiv - Biochemistry 2023Quote: Gene coding for human phosphatidylinositol 4,5-bisphosphate phosphodiesterase delta-1 PH domain 11-140aa (PLCδ, Acc# P51178.2) was synthesized by GeneArt (Invitrogen) as a codon optimized open reading frame ...
-
bioRxiv - Molecular Biology 2023Quote: Cells were plated on Nunclon™ Delta Surface flat-bottomed 24-well plates (#142475; Thermo Fisher Scientific Inc.), each well containing 1.0 x105 cells in 1 ml media as described above ...
-
bioRxiv - Neuroscience 2019Quote: ... Approximately 2μg peptide from each fraction was injected into an Acclaim peptide trap column (Thermo Fisher) via the Dionex RSLCnano autosampler ...
-
bioRxiv - Cell Biology 2021Quote: ... 100pmol biotinylated peptides (Peptide 2.0) were bound to 8μl streptavidin M-280 Dynabeads (Thermo Fisher Scientific) for 30mins in PBS at room temperature with agitation ...
-
bioRxiv - Genomics 2022Quote: ... Concentration of the stock H4K16ac peptide was analyzed by Pierce Quantitative Fluorometric Peptide Assay (Thermofisher Scientific). Spectra were collected with [15N-BD ...
-
bioRxiv - Genomics 2021Quote: ... The concentration of eluted peptides was determined by Pierce™ Quantitative Fluorometric Peptide Assay (Thermo Scientific). The peptides were dissolved in 0.1% [vol/vol] TFA and 2% [vol/vol] acetonitrile (ACN) ...
-
bioRxiv - Biochemistry 2021Quote: Peptide yields for optimisation were determined using the Pierce™ Quantitative Fluorometric Peptide Assay (Thermo Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... The peptide concentrations were further determined by Quantitative Fluorometric Peptide Assay (Thermo Scientific™ Pierce™). Finally ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were eluted from the corresponding beads using 3XFLAG peptide or HA peptide (Thermo Fisher Scientific). 5 μg His6-RavJ or His6-RavJC101A were added to the in vitro assay and the reaction was left in the 37°C incubator for 2 h ...
-
bioRxiv - Zoology 2022Quote: ... The redissolved peptides were measured using a colorimetric peptide assay kit (Thermo Fisher Scientific, MA, USA) and transferred to a hydrophilic-coated low adsorption vial (ProteoSave vial ...
-
bioRxiv - Molecular Biology 2024Quote: ... Each fraction (∼4.5 mg peptides) was used for peptide enrichment with either M280 streptavidin beads (Invitrogen), MyOne streptavidin beads (Invitrogen) ...
-
The conserved membrane-proximal domain of Sbh1/ Sec61β guides signal peptides into the Sec61 channelbioRxiv - Biochemistry 2024Quote: ... Peptide – peptide interactions were detected using the SuperSignal West Pico PLUS chemiluminescent substrate (Thermo Fisher Scientific). The signals were acquired using the AI600 Imager (Amersham ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting peptide samples were desalted with a PierceTM Peptide Desalting Spin Column (Thermo Fisher Scientific) according to manufacturer’s instruction and then completely dried under speed-vacuum.
-
bioRxiv - Cell Biology 2023Quote: ... and peptide concentrations were determined using the Pierce™ Quantitative Fluorescent Peptide Assay (Thermo Scientific, USA). Next ...
-
bioRxiv - Cell Biology 2023Quote: ... Total peptide quantification was performed using the Pierce Quantitative Colorimetric Peptide Assay (Thermo Fisher Scientific, USA) to normalise sample peptide concentrations for LCMS analysis ...
-
bioRxiv - Biochemistry 2023Quote: ... Detected peptides were searched against the protein sequences using BioPharma Finder 5.0 Peptide mapping (Thermo Fisher) and PMI Byologic (Protein Metrics Inc.).
-
bioRxiv - Cancer Biology 2024Quote: ... peptide concentration was measured using the Pierce Quantitative Colorimetric Peptide Assay Kit (23275, Thermo Fisher Scientific) to ensure an equal amount of each sample was labeled ...
-
bioRxiv - Pathology 2024Quote: Estimation of peptide concentration directly in the peptide digest using the Qubit assay (Thermo Fisher Scientific) was performed as indicated in the manufacturer’s protocol.
-
bioRxiv - Systems Biology 2024Quote: ... The labeled peptides were then fractionated by High pH Reversed-Phase Peptide Fractionation Kit (Thermo Scientific). The peptide mixture was reconstituted and acidified with 0.1% TFA solution and loaded to the equilibrated ...
-
bioRxiv - Biochemistry 2024Quote: ... The peptide concentration of the supernatant was quantified using the Pierce Colorimetric Peptide Assay (ThermoFisher 23275). The supernatant was then transferred to mass spectrometry vials for loading and characterization by Q-Exactive Mass Spectrometry ...
-
bioRxiv - Neuroscience 2021Quote: ... Blocking solution was replaced with antibody solution consisting of blocking solution with antibodies as follows: mCherry (Invitrogen, M11217) 1:500 ...
-
bioRxiv - Bioengineering 2020Quote: Peptides were purchased from Thermo Scientific Custom Peptide synthesis service ...
-
bioRxiv - Neuroscience 2019Quote: ... Peptides were synthesized by Thermo Scientific and GL Biochem Ltd.
-
bioRxiv - Systems Biology 2020Quote: ... 4μM fluorescein-tagged peptide (#F1314, Invitrogen) was loaded in the left side of the set-up ...
-
bioRxiv - Immunology 2020Quote: Custom peptides were synthesized by ThermoFisher. V3 peptides were resuspended in water at 1 mg/mL ...
-
bioRxiv - Biochemistry 2022Quote: Peptides were purchased from Thermo Scientific Custom Peptide synthesis service and Vivitide ...
-
bioRxiv - Biophysics 2022Quote: Peptides were synthesized by Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Developmental Biology 2023Quote: Peptides were synthesized commercially (ThermoFisher Scientific) TVSVPVEGR ...
-
bioRxiv - Neuroscience 2020Quote: Short hairpin RNAs against the mu and delta receptors were designed using BLOCK-IT RNAi Designer software (Invitrogen, USA). The sequences of the 21-nt fragments complementary to the target mRNAs were GCTGCCCTTTCAGAGTGTTAA (Oprm1-1) ...
-
bioRxiv - Cell Biology 2021Quote: ... Wild type and Ex6KO cell lines were plated on a 6-well plastic plate (Nunclon Delta Surface,ThermoFisher Scientific). When confluent ...
-
bioRxiv - Microbiology 2019Quote: ... CO2 was then introduced to a Delta V Plus IRMS using a ConFlo IV interface (Thermo Scientific, Bremen, Germany) in the Caltech Stable Isotope Facility ...
-
bioRxiv - Microbiology 2021Quote: ... Exponential phase starter cultures (OD600∼ 0.5 - 1.5) were diluted to OD600 = 0.01 and grown in 96-well Nunclon Delta surface clear plates (Thermo Scientific) with 150 μL per well ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 µl of cell supernatant was transferred to a 96-well white microplate (polystyrene, Nunclon Delta, Nunc, ThermoFisher Scientific) to measure the basal luminescence ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 µl of cell supernatant was transferred to a 96-well white microplate (polystyrene, Nunclon Delta, Nunc, ThermoFisher Scientific) to measure the basal luminescence ...
-
bioRxiv - Zoology 2023Quote: ... and gut content were measured on a Finnigan Delta Plus isotope ratio mass spectrometer (IRMS; Thermo Fisher Scientific, USA) coupled to the GC via a combustion GC-c-III interface (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... MoDCs were removed from 12-well Nunclon™ Delta surface-treated flat bottom plates (Thermo Fisher Scientific, Waltham, MA), pelleted ...
-
bioRxiv - Physiology 2023Quote: ... Germany) coupled with isotope ratio mass spectrometry (Delta Plus XP iRMS, Thermo Scientific; coupling via: Conflo III, Thermo Scientific).
-
A nepenthesin insert allosterically controls catalysis in the malaria parasite protease plasmepsin VbioRxiv - Microbiology 2022Quote: ... blocked in StartingBlock blocking buffer (ThermoFisher Scientific), and probed with mouse anti-PMV 1:50 (16 ...
-
bioRxiv - Cell Biology 2022Quote: ... and blocking with goat serum (Invitrogen, #31873), slides were stained sequentially scanned ...