Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for Neuronal acetylcholine receptor subunit alpha 5 NACHRA5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: Neuronal suspensions were labelled at 37°C with a combination of the Fluo-4 calcium indicator (5 μg/ml; Invitrogen) and either Alexa-Fluor 594-coupled Wheat Germ Agglutinin (WGA ...
-
bioRxiv - Immunology 2019Quote: ... and human bronchial carcinoma Calu3 epithelial cells (ATCC_HTB-55) were grown in 10% FCS in alpha MEM media (Gibco). Human alveolar epithelial carcinoma A549 epithelial cells (ATCC_CCL-185 ...
-
bioRxiv - Cell Biology 2021Quote: ... Alpha-actinin-1-M-sstFRET containing the sstFRET module inserted between 300aa and 301aa within the first spectrin repeat of human alpha-actinin-1 (P12814.2) was in the neomyocin selectable pcDNA3.1 expression vector (Invitrogen/ThermoFisher). Actinin-C-sstFRET containing the sstFRET module added to the C-terminus of human alpha-actinin-1 (P12814.2 ...
-
bioRxiv - Cell Biology 2020Quote: ... Human alpha thrombin (Nordic Diagnostica AB, Billdal, Sweden) was resuspended in OptiMEM reduced serum medium (RSM) (Thermo Fisher Scientific) to 1 U/μl and stored at −20 °C ...
-
bioRxiv - Microbiology 2023Quote: Human pharyngeal carcinoma Detroit 562 epithelial cells (ATCC_CCL-138) were grown in 10% FCS in alpha MEM media (Gibco). For each set of experiments ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 stably expressing the tetracycline (tet)-repressor (Flp-In T-REx HEK293, Invitrogen, Carlsbad, CA, USA) were cultured as above with the addition of 50 μg/mL zeocin and 5 μg/mL blasticidin (Invitrogen ...
-
bioRxiv - Biochemistry 2019Quote: HEK293 cells: HEK293 cells (CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045) were cultured in DMEM high glucose (Gibco) and supplemented with 10% FCS (Gibco) ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 5% human serum (Gibco, 1027-106). Expanded cells were used to measure peptide-specific T cell activation or stained using pMHC tetramers to detect T cells recognizing SARS-CoV-2 epitopes.
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg/mL human recombinant insulin (Thermo Fisher), and 1 μg/mL hydrocortisone (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 ug/ml human Gibco transferrin (Fisher Scientific), 1 ug/ml human insulin (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... and anti-transferrin receptor (Invitrogen). For the screening of compounds with the potential to rescue GlyT2 defective phenotypes the following chemicals were used ...
-
bioRxiv - Cell Biology 2023Quote: ... Transferrin receptor (Invitrogen, 13-6890), NHE5 (PA5-37222) ...
-
bioRxiv - Biochemistry 2021Quote: ... FreeStyle HEK293 cells (Thermo fisher scientific) were transfected with pcDNA3.1 vector encoding for HSulf-2 cDNA flanked by TEV cleavable SNAP (20.5 kDa ...
-
bioRxiv - Cell Biology 2021Quote: Low-passage HEK293 cells (Thermo Fisher) were co-transfected with 10 μg lentiviral vector (pCDH-SYN1-sypHy ...
-
A nepenthesin insert allosterically controls catalysis in the malaria parasite protease plasmepsin VbioRxiv - Microbiology 2022Quote: ... we transfected HEK293-F cells (ThermoFisher) using a modified version of the protocol in (41) ...
-
bioRxiv - Biochemistry 2021Quote: HEK293 Flp-In T-Rex (Invitrogen), HeLa (Austin et al. ...
-
bioRxiv - Biophysics 2021Quote: Suspension-adapted HEK293 Freestyle cells (Invitrogen) in serum free media (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: HEK293 TREx cells (Invitrogen Canada Inc.) were cultured in high-glucose Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Microbiology 2023Quote: ... the Expi-HEK293 cells (Thermo Scientific) were transfected with the mammalian expression plasmid pHLSec containing the recodonized SUB1 ...
-
bioRxiv - Microbiology 2023Quote: ... and HEK293-S cells (ThermoFisher Scientific) were cultured in FreeStyle293 expression medium (Life Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... FreeStyle™ HEK293-F cells (Gibco) were co-transfected with two plasmids ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were plated at a density of 5×104 mononuclear cells per cm2 in alpha MEM (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2021Quote: Lund human mesencephalic (LUHMES) neuronal precursors were grown in T75 flasks in proliferation medium (DMEM/F12 GlutaMAX™ supplement medium (Thermo Fisher Scientific), N2 supplement (Thermo Fisher Scientific ...
-
Corticocortical Connections of the Rostral Forelimb Area in Rats: A Quantitative Tract-Tracing StudybioRxiv - Neuroscience 2020Quote: ... Cholera toxin beta subunit conjugated to AlexaFluor 647 (CTB647, 5 µg/µL in 0.9% sterile saline, C34778, Invitrogen, Grand Island, NY) was injected (with the same configuration and outside diameter as BDA10kDa ...
-
bioRxiv - Neuroscience 2023Quote: ... Rats were anesthetized using vaporized isoflurane and bilaterally injected with 5 µg of Alexafluor-555 labeled fluorescent choleratoxin subunit b (fCTb) (Invitrogen C34776) into the left and right side of the ARC using the following coordinates from bregma ...
-
bioRxiv - Biochemistry 2020Quote: ... 6x-His-tagged constructs of human and murine SNED1 cloned into pCDNA5/FRT (Thermo Fisher, Waltham, MA) between the FseI and AscI sites were used to transiently transfect 293T cells to validate the anti-SNED1 antibody generated in this study (Supplementary Figure S1) ...
-
bioRxiv - Cell Biology 2019Quote: ... or anti-alpha Tubulin (Invitrogen) antibody for 4 hours at room temperature or overnight at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-alpha-tubulin (ThermoFisher, #62204), anti-LAMP2 (BioLegend ...
-
bioRxiv - Developmental Biology 2023Quote: ... alpha-MEM (Thermo Fisher Scientific) was supplemented with 2.5 % FBS ...
-
bioRxiv - Immunology 2021Quote: The COVID-19 receptor-binding domain (RBD) and the N-terminal peptidase domain of human ACE2 were expressed using HEK293F cells (Invitrogen). The COVID-19 RBD (residues Arg319-Phe541 ...
-
bioRxiv - Immunology 2023Quote: ... Expression constructs for M35-V5/His and M27-V5/His (both in pcDNA3.1-V5/His, Invitrogen) have been described previously (Munks et al ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytochrome c oxidase subunit 1 (COX1; 459600) from Invitrogen; Cytochrome c oxidase subunit 2 (COX2 ...
-
bioRxiv - Neuroscience 2020Quote: ... or Cholera Toxin Subunit B (Thermo Fisher Scientific, C34778).
-
bioRxiv - Biochemistry 2023Quote: ... namely the IR β-subunit antibody (Invitrogen, cat.no. AHR0271), IGF-1R β (111A9 ...
-
bioRxiv - Biophysics 2019Quote: Human embryonic kidney cells 293 (HEK293-6E, NRC, Canada) were cultured in FreeStyle F17 expression medium (Thermo Fisher Scientific, Waltham, MA) supplemented with 2 mM L-glutamine (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... N-terminal FLAG-tagged human MCC (P23508-1) constructs (pCMV2B vector) were transfected into HEK293 cells and selected with G418 (Gibco #10131035). G418-resistant cells were grown ...
-
bioRxiv - Biophysics 2021Quote: Human wild type ABCG2 or ABCG2 R184A containing an N-terminal Flag-tag was expressed in HEK293-EBNA (Thermo Fisher Scientific) cells as previously described19 ...
-
bioRxiv - Molecular Biology 2021Quote: ... the coding sequence encoding human TSPO (hTSPO) was amplified from cDNA previously generated by reverse transcription from total HEK293 mRNA isolated using Trizol (Life Technologies) and cloned into either a pENTR/SD/TOPO vector (Invitrogen ...
-
bioRxiv - Genetics 2024Quote: Flag-tagged wild type and mutated human RBBP5 plasmid were transfected to HEK293 cells by lipofectamine 3000 according to manufacturer’s protocol (Invitrogen, CA, USA). Cells were lysed by RIPA buffer and 20μg of whole cell lysate were used to assess protein expression in Western blot ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293 and MS2-tagged HEK293:24xMS2-NEAT1 cells were cultured in Dulbecco’s modified eagle’s medium (DMEM, Gibco) with 10% fetal bovine serum (FBS ...
-
Machine Learning Ensemble Directed Engineering of Genetically Encoded Fluorescent Calcium IndicatorsbioRxiv - Bioengineering 2023Quote: ... Cells were washed 2x by spinning at 0.7 rcf for 5 minutes at room temperature and removing supernatant + resuspending in 10 mLs of Neuronal Basal Media (Invitrogen; 10888022) supplemented with B27 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... centrifuged at 300g for 5 minutes at 4°C and homogenized in cold N-PER Neuronal Protein Extraction Reagent (Thermo Fisher) or cold RIPA lysis buffer (Thermo Fisher ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were washed 2x by spinning at 0.7 rcf for 5 minutes at room temperature and removing supernatant + resuspending in 10 mLs of Neuronal Basal Media (Invitrogen; 10888022) supplemented with B27 (Invitrogen ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were washed 2x by spinning at 0.7 rcf for 5 minutes at room temperature and removing supernatant + resuspending in 10 mLs of Neuronal Basal Media (Invitrogen; 10888022) supplemented with B27 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Fetal brains were evaluated by Western blot (corticotropin releasing factor receptor 1 [CRFR1]; glucocorticoid receptor [GR], interleukin [IL]-6 receptor [IL-6R]; IL-17A and β-actin, Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Neuroscience 2024Quote: ... DRG neurons or HEK293 cells were incubated with 5 μM Fura-2 AM and 0.2% Pluronic (Thermo Fisher Scientific) (prepared from a 200 mg/ml stock solution in DMSO ...
-
bioRxiv - Neuroscience 2024Quote: HEK293 cells were maintained in high glucose Dulbecco’s modified Eagle’s medium 5 g/L glucose (DMEM; Gibco, UK, 11965084). Cell culture media were supplemented with 10% (v/v ...
-
bioRxiv - Bioengineering 2022Quote: ... The serum-free medium used for encapsulation was alpha minimum essential medium (alpha-MEM, Gibco) supplemented with 10 % bovine serum albumin (BSA ...
-
bioRxiv - Developmental Biology 2023Quote: ... sorted cells were cultured on irradiated OP9DLL1 monolayers in Alpha-MEM (Alpha-MEM, ThermoFisher, 12000063) supplemented with 20% FBS (HyClone) ...